Nature template - PC Word 97

Novel Cell type-specific aptamer-siRNA delivery system
for HIV-1 therapy

Jiehua Zhou

, Haitang Li

, Shirley Li

, John Zaia2

& John J Rossi

Division of Molecular Biology,;

Division of Virology, Beckman Research Institute of

the City of Hope, Duarte,California 91010

Present address: J. J. Rossi. Division of Molecular Biology, Beckman Research Institute of the City of

Hope, Duarte, California 91010, USA. (

jrossi@coh.org

)

Summary

The successful use of small interfering RNAs (siRNAs) for therapeutic purposes

requires safe and efficient delivery to specific cells and tissues. Here we demonstrate

cell type-specific delivery of anti-HIV siRNAs via fusion to an anti-gp120 aptamer. The

envelope glycoprotein is expressed on the surface of HIV-1 infected cells, allowing

binding and interalization of the aptamer-siRNA chimeric molecules. We demonstrate

that the anti-gp120 aptamer-siRNA chimera is specifically taken up by cells expressing

HIV-1 gp120, and the appended siRNA is processed by Dicer, releasing an anti-tat/rev

siRNA which in turn inhibits HIV replication. We show for the first time a dual

functioning aptamer-siRNA chimera in which both the aptamer and the siRNA portions

have potent anti-HIV activities and that gp120 expressed on the surface of HIV infected

cells can be used for aptamer mediated delivery of anti-HIV siRNAs.

RNA interference (RNAi) is a process of sequence-specific post-transcriptional gene

silencing triggered by small interfering RNAs (siRNA). The silencing is sequence

specific and one of the two strands of the siRNA guides the RNA induced silencing

complex (RISC) to the complementary target, resulting in cleavage and subsequent

destruction of the target RNA

. RNAi is rapidly becoming one of the methods of choice

for gene function studies, and is also being exploited for therapeutic applications

2, 3

. The

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

successful therapeutic applications of RNAi are critically dependent upon efficient

intracellular delivery of siRNAs

. Currently, there are several methods to deliver siRNA

in vivo. These can be divided into physical and mechanical methods (hydrodynamic tail

vein injections in mice

4, 5, 6

, electroporation

7, 8, 9

, ultrasound

, and the gene gun

); local

administration

(intravenous injection

, intraperitoneal injection, subcutaneous

injection); and chemical methods (cationic lipids

13, 14

, polymers

15, 16, 17, 18, 19, 20

, and

peptides

21, 22, 23, 24

). However, the delivery efficiency (desired dose), uncontrollable

biodistribution and delivery-related toxicitities must be carefully analyzed. Recently, the

cell type-specific delivery of siRNAs has been achieved using aptamer-siRNA

chimeras

. In this system, the aptamer portion mediated binding to the prostate-specific

membrane antigen (PSAM), a cell-surface receptor and the siRNAs linked to the

aptamer was selectively delivered into PSMA expressing cells resulting in silencing of

target transcripts both in cell culture and in vivo following intratumoral delivery. In a

similar study

a modular streptavidin bridge was used to connect lamin A/C or GAPDH

siRNAs to the PSMA aptamer. Consequently, this system induced silencing of the

targeted genes only in cells expressing the PSMA receptor.

In the present study, we took advantage of the gp120 glycoprotein

27, 28

binding

properties of an anti-gp120 RNA aptamer to explore the potential of using this aptamer

for delivery of anti-HIV siRNAs into HIV infected cells. Based upon our own previous

studies

29, 30

, we tested the aptamer as a chimeric transcript with a Dicer substrate RNA

duplex (25-30 nt). We utilized a 27 mer siRNA in which one strand is covalently

attached to the aptamer, and the second strand is base paired to the upper strand and

compared a 27 base pair dsRNA with a 21 base pair dsRNA fused to the aptamer in an

analogous fashion. The anti-gp120 aptamer binding to the R5 version of HIV-1 gp120

has been previously demonstrated

31.

This aptamer was shown to neutralize HIV-1

infectivity

31, 32, 33

by direct binding to gp120 in virions. We wanted to determine

whether or not the anti-gp120 aptamer could provide selective binding and subsequent

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

internalization into HIV infected cells which should express gp120 on the cell surface.

Although the aptamer alone provided some inhibitory function when tested in this

setting, the siRNA chimeras provided more potent inhibition than the aptamer alone,

suggesting cooperativity between the siRNA and aptamer portions in inhibiting HIV

replication and spread. Our results demonstrate that the gp120 aptamer-siRNA chimeras

are internalized in cells expressing gp120 either ectopically or from HIV infection, and

moreover the chimeric RNAs provide potent and lasting inhibition of HIV replication in

T-cells in culture. These results support the concept of using aptamer-siRNA conjugates

for systemic treatment of HIV infection. This approach has the major advantage of not

relying upon gene therapy, and the siRNAs can be changed or multiplexed to avert viral

resistance.

Design of anti-gp120 aptamer-siRNA chimeras

To enhance the stability of the chimeric RNAs in cell culture and in vivo

4, 34, 35, 36, 37

, the

aptamer and sense strand segment of the siRNAs contained nuclease-resistant 2'-Fluoro

UTP and 2'-Fluoro CTP and were synthesized from corresponding dsDNA templates by

in vitro bacteriophage transcription (Fig 1). To prepare the siRNA containing chimeras,

in vitro transcribed chimeric aptamer-sense strand polymers were annealed with

equimolar concentrations of an unmodified antisense strand RNA. These 2'-Fluoro

modified chimeras were stable in cell-culture media for up to 48 hours whereas the

unmodified control RNAs were quickly degraded within several minutes (data not

presented).

The gp120-binding aptamer which neutralizes R5 strains of HIV-1 has been

previously described and characterized

. Since the synthetic Dicer substrate duplexes

of 25-30 nt have been shown to enhance RNAi potency and efficacy, we chose a 27 mer

duplex RNA as the siRNA portion our chimeric molecule. The 27 mer siRNA portion of

chimeras (Ch L-1 and Ch 1) targets the HIV-1 tat/rev common exon sequence. The

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

chimeras designed Ch L-2 and Ch 2 are identical to Ch L-1 and Ch 1 with the

exception that the 27 mer duplex is replaced by a 21 base pair duplex. In the Ch L-1

and Ch L-2 designs we inserted a four nucleotide linker (CUCU) between the aptamer

and siRNA portions to minimize steric interference of the aptamer portion with Dicer.

Previous studies on the anti-gp120 aptamer identified the minimal region of the aptamer

essential for binding gp120 and showed mutations within this region significantly lower

the binding affinity. As controls for aptamer binding we created the chimera designated

as M-1. As a control for the siRNA mediated silencing we constructed an additional

mutant in the siRNA portion which should abrogate RNAi directed cleavage of the

target, and this is designated as M-2.

Because of competition by the sense (passenger) strand with the anti-sense

(guide) strand for RISC entry, the strand selectivity is an important factor for evaluating

siRNAs. Therefore, we evaluated these chimeras RNA using the SiCheck reporter

system, which readily allows screening of the potencies of candidate sh/siRNAs. The

gene silencing of both the sense target (corresponding to the mRNA) and the anti-sense

target were tested independently and the selectivity ratios could be calculated as a

measure of the relative incorporation of each strand into the RISC. The comparison (Fig

S1) demonstrated that the Ch L-1 mediated ~86% knockdown of the sense target;

however, knockdown of the anti-sense target is much less (~50 %), indicative of good

strand selection (R = 3.2). Ch 1 also indicated similar knockdown (~ 83%) of the sense

target and strand selection (R = 2.9). In contrast, Ch L-2 and Ch 2 have poorer efficacy

(<70%) and strand selectivity (R = 1.9 and 1.6, respectively). These data suggest that

the aptamer-27 mer siRNA chimeras indeed enhance the RNAi efficacy and potent,

consistent with previous studies in our laboratory

29, 30

Anti-gp120 aptamer-siRNA chimeras bind and are internalized by cells expressing

HIV gp160

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

Style tag for displayed matter CHO-gp160 cells stably expressing the HIV envelope

glycoprotein gp160 were used to test uptake of the chimeric aptamer-siRNAs. These

cells do not process gp160 into gp120 and gp41 since they lack the gag encoded

proteases required for envelope processing. As a control we used the parental CHO-EE

cell line which does not express gp160. The anti-gp120 aptamer and the chimeras were

labeled with Cy3 to follow their binding and potential internalization in gp160

expressing cells. Flow cytometric analyses (Fig 2a) revealed that the aptamer and

chimeras specifically bound to the CHO-gp160 cells but did not bind to the control

CHO-EE cells. As anticipated, the M-1 dramatically reduced binding to the CHO-gp160

expressing cells.

In order to determine if the bound aptamer and chimeras were internalized in the

gp160 expressing cells, we carried out Z-axis confocal microscopy and three-

dimensional image reconstruction with the CHO-gp160 cells incubated with the Cy3-

labeled transcripts. Both the anti-gp120 aptamer (data not presented) and Ch 1 (Fig 2b)

were selectively internalized within the CHO-gp160 cells but not the CHO-EE control

cells. The M-1 was also not internalized. Three-dimensional image reconstruction (Fig

2c) shows localization of the Cy3-labeled Chimera Ch 1 in a single cell. To visualize

the plasma membranes the cells were stained with the carbocyanine dye DIO.

Anti-gp120 aptamer-siRNA chimeras are processed by Dicer

We next asked whether or not the siRNAs could be processed from the chimeras by

Dicer in whole cell extracts that contain good Dicer cleavage activity. The first set of

experiments used a 5'-end P

labeled antisense strand to follow Dicer processing (Fig

3a). The size of the P

labeled cleavage product(s) indicates from which direction Dicer

enters the siRNA and cleaves. When Ch L-1 was incubated with the cytoplasmic lysate,

we observed that the 27 nt antisense strand was processed into a 21-23 nt siRNA. This

result suggests Dicer processing preferentially enters from the 5' end of the antisense

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

strand and cleaves 21 to 23 nt downstream, leaving the 5' end of the antisense strand

intact (Fig 3b). In contrast, the 21 base siRNAs were not processed further in these

extracts.

Anti-gp120 aptamer-siRNA chimeras specifically silence target gene expression

To evaluate whether these anti-gp120 aptamer-siRNA chimeras function in triggering

RNAi, we first transfected CHO-gp160 and CHO-EE cells with HIV pNL4-3 Luc. The

HIV pNL4-3 has the firefly luciferase under the control of the HIV LTR and is Tat

responsive. The anti-tat/rev siRNA efficacy is monitored by inhibition of luciferase

expression. Subsequent to the transfections the cells were treated with the chimeras in

the absence or presence of the transfection reagent Lipofectamine 2000.

Luciferase expression was potently inhibited when Ch L-1 and Ch 1 were

lipofected into both types of cells (Fig 4a). However, in the absence of lipofection, gene

silencing from Ch L-1 and Ch 1 was specific to CHO-gp160 expressing cells and no

inhibition of luciferase was observed in CHO-EE cells. Interestingly, Ch L-1 and Ch 1

which are linked to the 27 mer duplex RNA showed somewhat greater efficacy than

chimeras Ch L-2 and Ch 2, consistent with our previous observations of Dicer

substrates enhancing RNAi

29, 30

To validate that the siRNAs released from the chimeras were triggering RNAi we

transfected CHO-gp160 cells with a Rev-EGFP fusion construct harboring the siRNA

targets. The transfected cells were then transfected with Ch L-1, Ch L-2, 27 mer siRNA

or 21 mer siRNA in presence of Lipofectamine 2000. Thirty six hours post transfection

total RNA was isolated and subjected to a modified 5'-RACE (Rapid amplification of

cDNA ends) technique to identify the specific cleavage products in the Rev portion of

the fusion transcript. We assumed that the Ago2 mediated cleavage was between bases

10 and 11 relative to the 5' end of each siRNA. Our Dicer analyses of the 27 mer

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

revealed that it is cleaved 21-23 nucleotides downstream from the 5' end of the

antisense strand (antisense relative to the tat/rev target), whereas the 21 mer is not

processed further (Fig 3b). We expected that the RNAi mediated cleavage site in the

target would be shifted by six bases between the 27 mer and the 21 mer derived

siRNAs. Fragments of the predicted lengths were obtained from cells treated with the

siRNAs or chimeras (Fig 4b). Direct sequencing of the excised bands verified the

expected PCR product, which demonstrated that cleavage occurred at the predicted

position for the siRNA duplex between positions 10 and 11 from the 5' end of the

siRNA antisense strand (Fig S3). These data provide a formal demonstration that the

chimeras produce siRNAs that are incorporated into RISC. As expected, no RACE PCR

products were generated from RNA isolated from cells untreated with the chimeras or

siRNAs.

Anti-gp120 aptamer-siRNA chimeras inhibit HIV gp120 mediated cell fusion and

HIV-1 infection CEM T-cells

Essential to the use of the aptamer-siRNA chimeras in treating HIV infection is that the

aptamer allows internalization of the chimeras in HIV infected cells. We first

demonstrated by Northern blot analyses that chimeric delivered siRNAs were detectable

in HIV infected CEM cells directly which were treated with the chimeras. The Northern

blotting data of Figure 5a demonstrate that the siRNAs from chimera are internalized in

HIV infected CEM cells since the 27 mer was processed to 21-23 base siRNAs in these

cells, but not in the gp120-negative uninfected CEM cells, suggesting that the chimeras

specifically delivered siRNA into the infected CEM cells through anti-gp120

aptamer.As expected, the 21 or 27 mer duplex siRNAs in absence of the aptamers were

not detectable in the CEM cells owing to the lack of internalization (Fig 5a). Since a

little of non-specific bindings existed on the cells surface, tiny 21 or 27 RNA from

chimeras (Ch L-1, Ch 1 and Ch L-2) also were hybridized in uninfected CEM.

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

To further confirm siRNA function after internalization to infecterd CEM

cells, qRT-PCR was preformed to evaluate the tat/rev gene expression. Aptamer or

chimeras were added directly to media containing infected CEM cells. After 7 days,

treated cells were harvested, the total RNA was extracted and the extent of tat/rev gene

inhibition was determined by quantitative RT-PCR expression assays. We find that the

treatment of infected CEM cells with the chimeras is able to induce silencing of the

tat/rev gene, while the aptamer alone did not affect tat/rev gene expression (Fig 5b).

These results provide further support that the aptamer delivered siRNA triggers RNAi.

In HIV-1 infection, gp120 expressed at the cell surface will induce syncytia

formation between infected and uninfected cells due to interactions between gp120 and

CD4

27, 28

. We therefore sought to determine if the aptamer and chimeras would have an

impact on syncitia formation in cell culture. In this assay, the HIV-1 infected-CEM cells

were incubated with siRNA or chimeras RNAs. Subsequently, the uninfected MT2 cells

expressing CD4 were added into infected-CEM cells treated with RNA. After 48 h of

co-incubation at 37°C, cells syncytia were analyzed microscopically. The treatment of

the HIV infected cultures with the aptamer and chimeras resulted in a clear reduction in

syncytia formation (Data not presented). We also asked if the aptamer and chimeras

prevent HIV replication in an acute infection assay by monitoring HIV-1 Gag p17 via

an immunofluorescence assay (IF). These assays revealed a marked reduction in p17

expression in cells cells treated with the anti-gp120 aptamer and even more pronounced

reduction with the Ch L1 chimera (Fig S4).

To further verify the activity of the anti-HIV activity of the chimeras in

inhibition of HIV-1 replication, we carried out the following assays. In the first assay,

HIV-1 was first mixed with the chimeras or aptamer and subsequently the viruses were

used to infect CEM cells. In this assay the infectivities of the aptamer or chimera treated

virus were significantly reduced and viral replication was suppressed out to two weeks

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

(Fig 5c). Ch L-1 was the most effective inhibitory agent. In the second experiment, the

aptamer or chimeras were incubated with HIV infected-CEM cells. At different days

post treatment with the aptamer and chimeras, aliquots of the media were assayed for

viral p24 antigen levels. The results of these analyses (Fig 5d) showed that all of the

aptamer containing RNAs inhibited p24 production, but the strongest inhibition was

observed with Ch L-1 treatment, again consistent with our results from the other assays.

These data, together with the inhibition of cell fusion and p17 expression, demonstrate

that the anti-gp120 aptamer-siRNA chimera system can strongly inhibit HIV-1

replication and infection. Moreover, the suppression is attributed to the combined affect

of the aptamer binding gp120 and RNAi.

Anti-gp120 aptamer-siRNA chimeras do not trigger an interferon response

It has been reported previously that siRNAs delivered by liposomes or polyplex

reagents can non-specifically activate inflammatory cytokine production (TNF

, IL-6

and IL-12) as well as IFN responsive genes, which in turn can trigger cellular toxicity

38,

39, 40

. We therefore assessed the induction of type I interferon regulated gene expression

by our anti-gp120 aptamer-siRNA chimeras using quantitative RT-PCR expression

assays. As a positive control, we incubated the target cells with poly(IC). We find that

the treatment of HEK293 cells with the chimeras did not significantly induce expression

of the interferon- and p56 genes (Fig 6a). Since CEM cells are difficult to be transfect

with control molecules such as poly (IC), we used IFN-

as a positive control to

confirm upregulation of p56 and OAS1 gene expression. As we observed in the

HEK293 transfection assays, treatment of CEM cells with the chimeras did not induce

type I IFN responses (Fig 6b). Similar results were obtained using HIV infected CEM

cells treated with the chimeras, suggesting that the gp120 mediated internalization of the

chimeras does not trigger toxic IFN responses.

Discussion

Aptamers are nucleic acid species that have been engineered through repeated rounds of

in vitro selection to bind to various molecular targets such as small organic molecules,

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

proteins, nucleic acids, and even cells

41, 42, 43

. Because aptamers are capable of binding

with high specificity to their ligands at low nano- to picomolar dissociation constants

they can be used as molecular drugs for both basic research and clinical purposes

44, 45, 46,

47, 48

The success of RNAi-based clinical applications is dependent upon the efficiency

of siRNA delivery to target cells. In this report, we have capitalized upon the exquisite

specificity of a gp120 aptamer to deliver anti-HIV siRNAs into HIV infected cells with

the net result that replication and spread of HIV is strongly inhibited by the combined

action of the aptamer and siRNA targeting the tat/rev common exon of HIV-1.

We utilized the HIV-1 envelop protein gp120 as a model receptor for targeted

intracellular delivery of anti-HIV siRNAs. Cell type-specific binding and uptake of

chimeric aptamer-siRNA conjugates were achieved through the interaction of the

aptamer portion with gp120 on the cell surface of infected cells. To insure the stability

of our RNA chimeric molecules in sera, we utilized the RNA stabilizing 2'-Fluoro

backbone modifications of pyrimidines on the aptamer and siRNA sense strand. The

antisense strand was no chemically modified, but was in fact stabilized by virtue of its

base pairing to the modified sense strand.

Notably, the cell type-specific gene silencing revealed that the siRNAs were

successfully delivered into cells and entered into the RNAi pathway by interaction of

the anti-gp120 aptamer with gp120 expressed on the cell surface. Interestingly, the

chimeras containing a 27 mer duplex RNA gave better efficacy in gene silencing than

the corresponding 21 mer duplex containing chimeras. The 27 mer duplex alone was

also more potent than the 21 mer duplex when these RNAs were delivered by

lipofection. We attribute this increased potency to Dicer processing of the 27 mer

wherein the processed 21-23 mer siRNAs are more readily handed off to RISC. It is of

interest that we never observed complete processing of the 27 mer into 21-23 mers in

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

our Northern Blot analyses of cells treated with the chimeras. This may in part be a

consequence of the high intracellular concentrations achieved by aptamer delivery, but

may also reflect that the design of our blunt ended duplexes is sub-optimal for Dicer

processing. We observed that rather than enter the duplex from the 2 base 3' overhang,

Dicer cleavage initiated following entry onto the duplex from the blunt end of the

duplex. To this end we are testing other structures of the siRNA portion of the aptamers

to achieve more complete Dicing.

An interesting observation is that analyses of the target cleavage products by a 5'-

RACE technique further demonstrated that neither the 27 mer or 21 mer siRNAs

underwent processing to trigger duplexes with two base 3' overhangs on both ends of

the siRNAs. In fact for both the 21 mer and 27 mer derived siRNAs, the target mRNA

was cleaved between positions 10 and 11 relative to the blunt 5' end of the siRNA

antisense strand. These results suggest that unprocessed 27 mer as well as Dicer

processed 27 mer antisense strands may be incorporated into RISC. Given the results

from the cell extract Dicing reaction, which revealed that the 27 mer is not processed at

the 5' end of the antisense but only at the 3' end, it is not possible to determine whether

all, some or none of the activated RISC was derived from intact 27 mer antisense

getting incorporated directly into RISC.

Aptamers that bind to viral or cellular proteins with high affinity and specificity

are useful for therapeutic applications. In this study, both aptamer and chimeras can

dramatically suppress the replication and production of HIV-1 in a variety of assays.

These results demonstrate important attributes of the anti-gp120 aptamer as both

inhibitors of HIV via direct binding to virion or intracellular gp120 and as a cell type

specific delivery vector for therapeutic siRNAs.

Because the anti-gp120 aptamer is responsible for the targeted delivery of

siRNAs, gp120 expression is necessary for cell type-specific transport. This is in

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

essence a safety feature which could be capitalized upon to deliver siRNAs that target

HIV or even cellular messages essential for viral replication. Since only HIV infected

cells would bear the inhibitory action of the siRNA, this approach greatly minimizes

potential off-target effects by the siRNAs.

The dual inhibitory potential of the aptamer-siRNA fusion is an important point

of discussion. Both the aptamer and chimeras showed strong inhibition of syncitial cell

formation, expression of HIV-1 Gag p17 and HIV replication and spreading in HIV-1

infected-CEM T-lymphocytes. The anti-gp120 aptamer neutralizes HIV-1 infectivity via

blocking the interaction of gp120 and CD4, and the siRNA silences tat/rev expression.

Thus, the anti-gp120/HIV chimeras serve a double-function and therefore provide

greater efficacy than either the aptamer or siRNA applied alone. Finally, we show that

the aptamer mediated delivery of siRNAs via binding to gp120 and subsequent

internalization does not trigger type I interferon gene responses in different cell lines.

In summary, this strategy provides a new paradigm for delivery of anti-HIV

siRNAs by allowing selective delivery to HIV infected cells and dual function inhibition

of HIV replication and spread. Moreover, the aptamer and siRNAs can be readily

changed to accommodate genetic changes in the virus, making, making this an attractive

approach for systemic anti-HIV therapy.

Methods

Materials. Unless otherwise noted, all chemicals were purchased from Sigma-Aldrich,

all restriction enzymes were obtained from New England BioLabs (NEB) and all cell

culture products were purchased from GIBOC (Gibco BRL/Life Technologies, a

division of Invitrogen.); DuraScribe T7 transcription Kit (EPICENTRE

Biotechnologies); Silencer siRNA Labeling Kit (Ambion); Vybrant Cell-Labeling

Solution (Molecular Probes, Invitrogen); Galacto-Star System (Applied Biosystems);

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

CHO-Env Transfectants (CHO-WT and CHO-EE) (NIH); Magi cell line (NIH); HEK

293 cell line (ATCC); Random primers (Invitrogen); Bio-Spin 30 Columns (Bio-Rad);

Recombinant Human Dicer Enzyme Kit (Genlantis); Lipofectamine 2000 (Invitrogen)

siRNAs. siRNA and antisense strand RNA were purchased from Integrated DNA

Technologies (IDT). Site I (tat/rev) 27 mer: Sense sequence: 5'-

GCGGAGACAGCGACGAAGAGCUCAUCA-3'; Antisense: 5'-

UGAUGAGCUCUUCGUCGCUGUCUCCGCdTdT-3'; Site I (tat/rev) 21 mer: Sense

sequence: 5'- GCGGAGACAGCGACGAAGAGC-3'; Antisense: 5'-

GCUCUUCGUCGCUGUCUCCGCdTdT-3';

Aptamer-siRNA chimeras. (The 27 or 21 mer sense strand is marked in bold and

mutated nucleotides are underlined).

Aptmer:

5'- GGGAGACAAGACUAGACGCUCAAUGUGGGCCACGCCCGAUUUU

ACGCUUUUACCCGCACGCGAUUGGUUUGUUUCCC - 3'

Chimera L-1 sense strand:

5'- GGGAGACAAGACUAGACGCUCAAUGUGGGCCACGCCCGAUUUU

ACGCUUUUACCCGCACGCGAUUGGUUUGUUUCCCCUCUGCGGAGACAGC

GACGAAGAGCUCAUCA -3'

Chimera 1 sense strand:

5'- GGGAGACAAGACUAGACGCUCAAUGUGGGCCACGCCCGAUUUU

ACGCUUUUACCCGCACGCGAUUGGUUUGUUUCCCGCGGAGACAGCGACG

AAGAGCUCAUCA -3'

Chimera L-2 sense strand:

5'- GGGAGACAAGACUAGACGCUCAAUGUGGGCCACGCCCGAUUUU

ACGCUUUUACCCGCACGCGAUUGGUUUGUUUCCCCUCUGCGGAGACAGC

GACGAAGAGC -3'

Chimera 2 sense strand:

5'- GGGAGACAAGACUAGACGCUCAAUGUGGGCCACGCCCGAUUUU

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

ACGCUUUUACCCGCACGCGAUUGGUUUGUUUCCCGCGGAGACAGCGACG

AAGAGC -3'

Mutant-1 sense strand:

5'- GGGAGACAAGACUAGACGCUCAAUGUGGGCGGGGCCCGAUUUU

ACCGUUUUCAAAGCACGCGAUUGGUUUGUUUCCCCUCUGCGGAGACAGC

GACGAAGAGC -3'

Mutant-2 sense strand:

5'- GGGAGACAAGACUAGACGCUCAAUGUGGGCCACGCCCGAUUUU

ACGCUUUUACCCGCACGCGAUUGGUUUGUUUCCCCUCU

GCGGAGACAGCG

UGUAAGAGCUCAUCA -3'

Chimera L-1, chimera 1 and Mutant-1 antisense strand:

5'- UGAUGAGCUCUUCGUCGCUGUCUCCGCdTdT-3'

Chimera L-2, chimera 2 antisense strand:

5'- GCUCUUCGUCGCUGUCUCCGCdTdT-3'

Mutant-2 antisense strand:

5'- UGAUGAGCUCUUACACGCUGUCUCCGCdTdT-3'

Generation of aptamer and chimera RNAs by in vitro transcription. Double-

stranded DNA templates were directly generated by PCR and the resulting PCR

products were recovered using a QIAquick Gel purification Kit. Chimera sense strands

were transcribed from its PCR generated DNA templates using the DuraScription Kit

(Epicentre, Madison, WI) according to the manufacturer's instruction. In the

transcription reaction mixture, the canonical CTP and UTP were replaced with 2'-F-

CTP and 2'-F-UTP to produce RNA that is resistant to RNase A degradation. The

reactions were incubated at 37 °C for 16 h, and subsequently purified with Bio-Spin 30

Columns (Bio-Rad) following ethanol precipitation. RNA was treated by CIP to remove

the initiating 5'-triphosphate. To prepare the chimeras, the chimeras harboring only the

sense strand RNA was combined with the appropriate antisense RNA in HBS buffer (10

mM HEPES pH 7.4, 150 mM NaCl, 1 mM CaCl

, 1 mM MgCl

, 2.7 mM KCl), heated

to 95 °C for 3 min and then cooled to 37°C slowly. Incubation continued at 37°C for 10

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

min. Fluorescent aptamer and chimeras were generated using the Silencer siRNA

Labeling Kit (Ambio) according to the manufacturer's instructions.

Cell culture. HEK 293 cells and CEM cells were purchased from ATCC and cultured

in DMEM and RPMI 1640 supplemented with 10% FBS respectively, according to their

respective data sheets. CHO-WT and CHO-EE cells were obtained through the AIDS

Research and Reference Reagent Program, Division of AIDS, NIAID, NIH. They are

grown in GMEM-S. Cells were cultured in a humidified 5% CO

incubator at 37 °C.

Cell-surface binding of aptamer-siRNA chimeras (Flow cytometry analysis). CHO-

WT gp160 or CHO-EE cells were washed with PBS, trypsinized and detached from the

plates. After washing cells twice times with 500

L 1×HBS buffer (10 mM HEPES pH

7.4, 150 mM NaCl, 1 mM CaCl

, 1 mM MgCl

, 2.7 mM KCl, 0.01% BSA). Cell pellets

were resuspended in 1*HBS buffer and incubated at 37°C for 30 min. Cells were then

pelleted and resuspended in 50

L of 1*HBS (prewarmed to 37°C) containing either

400 nM Cy3-labeled aptamer or Chimera RNAs. After incubation at 37°C for 40 min,

cells were washed three times with 500

L of 1×HBS prewarmed to 37°C, and finally

resuspended in 350

L of 1×HBS buffer prewarmed to 37°C and analyzed by flow

cytometry.

Cellular binding and uptake studies. (Confocal Microscopy analysis). The CHO-

WT gp160 and CHO-EE cells lines were grown in 8-well chambered-slide with seeding

at 1×10

in GMEM-S medium to allow 50%-70% confluence in 24 h. On the day of

experiments, cells were washed with 250

L prewarmed PBS. And incubated with 250

L prewarmed completely growth medium for 30 min at 37°C. Cy3-labeled RNAs at 20

nM of final concentration were added into the media and incubated at 37°C for 1.5 hrs.

Subsequently, cells were washed three times with 250

L of prewarmed PBS, fixed

with 4% formaldhydes for 10 min. The cells were stained by treatment with 100

L of

Vybrant Cell-Labeling Solution (DIO membrane dye, Molecular Probes, Invitrogen)

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

according to the manufacturer's instructions. The images were collected using a Zeiss

LSM 510 upright 2 photon confocal microscopy system under water immersion at 40

magnifications. Images were combined and deconvoluted to reconstruct a three-

dimensional image.

Analysis of chimera processing. Sense RNAs were annealed with equal moles of 5'-

end-labeled antisense strands in HBS buffer in order to form chimeric dsRNA. The

chimeras or dsRNAs were incubated at 10 nM final concentration in the absence of

target mRNA in HCT116 cell lysates for varying times (20 min, 60 min and 120 min).

Reactions were stopped by phenol/chloroform extraction and the RNAs were collected

for electrophoresis in a denaturing 20% polyacrylamide gel. The gels were subsequently

dried and exposed to X-ray film.

Dual luciferase assays. (Day 1) CHO-gp160 and CHO-EE cells were transfected with

pNL4-3. Luc.R-.E- (NIH AIDS Research and Reagent Program, Germantown, MD) and

pRSV-Renilla using Lipofectamine 2000. pNL4-3.Luc.R-.E- is an Env- Vpr- non-

infectious clone containing the firefly luciferase (F-Luc) gene inserted into the nef gene.

(Day 2) Cells which transiently expressed pNL4-3.Luc were seeded in 24-well plates at

50-70% confluency. For siRNA, (Day 3) cells were transfected with 200 nM RNA

using Lipofectamine 2000. For aptamer-mediated siRNA delivery, (Day 3) cells were

incubated in 400

L refresh complete growth media for 30 min at 37°C. The chimeras

RNAs were added directly to the media (400

L) at a final concentration of 200 nM

chimeras. Cells were harvested for analysis on day 4. The expression of the pNL4-3.Luc

and normalizing control Renilla luciferase were detected by the Dual-luciferase

Reporter Assay System (Promega, USA) according to the manufacturer's instructions.

All samples were transfected in triplicate and the experiment was performed a minimum

of three times.

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

5'-RACE PCR assay. Total RNA (5

g) from CHO-gp160 cells treated with different

siRNAs and chimeras was ligated to a GeneRacer adaptor (Invitrogen) without prior

treatment. Ligated RNA was reversed transcribed using a gene specific primer 1 (GSP-

Rev 1: 5'-TCACCCTCTCCACTGACAGAGAACTT -3'). To detect cleavage products,

PCR was preformed using primers complementary to the RNA adaptor (5'-cDNA

primer: 5'- GGACACTGACATGGACTGAAGGAGTA -3') and gene-specific primer 2

(GSP-Rev 2: 5'- TAACCTCTCAAGCGGTGGTAGCTGAA -3'). Amplification

products were resolved by agarose gel electrophoresis and visualized by ethidium

bromide staining. The identity of the specific PCR products was confirmed by

sequencing of the excised bands.

Northern Blot analysis of CEM cells. CEM cells were infected by HIV NL4-3 for 10

days. Prior to adding the various RNAs, the infected-CEM cells were gently washed 3

times to clear out free virus. 5x10

cells were incubated with refolded RNAs at 400 nM

final concentrations in 96-well plates at 37°C. The total RNAs were harvested on the 7

day post application for analysis with STAT-60 (TEL-TEST "B", Friendswood, TX)

according to the manufacturer's instructions. Two micrograms of total RNAs were

electrophoresed in a15% polyacrylamide-8 M urea gel and then transferred to a Hybond

N+ membrane (Amersham pharmacia Biotech, USA). Prehybridization and

hybridization were carried out using PerfectHyb Plus Hybridization buffer (Sigma,

USA) at 37°C with 3 pmol of a 21-mer DNA oligonucleotide probe end-labeled with T4

polynucleotide kinase and -

P-ATP. Filters were washed three times at 37°C for 15

min, prior to autoradiography. We also probed for human U6 snRNA as an internal

RNA loading standard.

qRT-PCR analysis. CEM cells were infected with HIV NL4-3 for 10 days. Prior to

analyses,the infected-CEM cells were gently washed 3 times to eliminate free virus. The

infected CEM cells were treated directly with the aptamer or Ch L-1 (400 nM). After 7

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

d, total RNAs were isolated with STAT-60 (TEL-TEST "B", Friendswood, TX).

Expression of the tat/rev coding RNAs was analyzed by quantitative RT-PCR using 2X

iQ SyberGreen Mastermix (BIO-RAD) and specific primer sets at a final concentration

of 400 nM. Primers were as follows: tat/rev forward primer: 5'-

GGCGTTACTCGACAGAGGAG -3'; tat/rev reverse primer: 5'-

TGCTTTGATAGAGAAGCTTGATG -3'; GAPDH forward primer 1: 5'- CAT TGA

CCT CAA CTA CAT G-3'; GAPDH reverse primer 2: 5'- TCT CCA TGG TGG TGA

AGA C-3'.

RNA-Stat60 was used to extract total RNA according to the manufacturer's

instruction (Tel-Test). Residual DNA was digested using the DNA-free kit per the

manufacturer's instructions (Ambion). cDNA was produced using 2

g of total RNA

Moloney murine leukemia virus reverse transcriptase and random primers in a 15

reaction according to the manufacturer's instructions (Invitrogen). GAPDH expression

was used for normalization of the qPCR data.

HIV-1 challenges and p24 antigen assay. Method 1: NL4-3 virus was incubated with

refolded RNAs at 37°C for 1 h. Subsequently, viruses were gently washed with PBS

and used to infect CEM cells. The culture supernatants were collected at different times

post infection (7 d, 11 d, 15 d and 18 d) for p24 antigen analyses. Method 2: CEM cells

were infected with HIV NL4-3 for 10 days. Prior to RNA treatments the infected-CEM

cells were gently washed with PBS three times to remove free virus. 1.5×10

infected

CEM cells and 3.5×10

uninfected CEM cells were incubated with refolded RNAs at

400 nM final concentration in 96-well plates at 37°C. The culture supernatants were

collected at different times (3 d, 5 d, 7 d and 9 d). The p24 antigen analyses were

performed using a Coulter HIV-1 p24 Antigen Assay (Beckman Coulter) according to

the manufacturer's instructions.

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

Interferon assay (qRT-PCR analysis). For HEK293 cells, the cells were transfected

with siRNA and chimeras RNAs (50 nM) or 200 ng poly(IC) using lipofectamine 2000

(Invitrogene). For infected CEM cells, cells were directly treated with chimera RNAs

(400 nM) or IFN-alpha (100 U/mL). After 24 h, total RNAs were isolated with STAT-

60 (TEL-TEST "B", Friendswood, TX). Expression of human mRNAs encoding IFN-,

p56(CDKL2) and OAS1 were analyzed by quantitative RT-PCR using 2X iQ

SyberGreen Mastermix (BIO-RAD) as described above and specific primer sets for

these genes at final concentrations of 400 nM. Primers were as follows: GAPDH primer

1: 5'- CAT TGA CCT CAA CTA CAT G-3'; GAPDH primer 2: 5'- TCT CCA TGG

TGG TGA AGA C-3'; IFN- forward, 5'-AGACTTACAGGTTACCTCCGAA-3';

IFN- reverse, 5'-CAGTACATTCGCCATCAGTCA-3'; P56 (CDKL2) forward, 5'-

GCCTCCTTGGGTTCGTCTATAA-3'; P56 (CDKL2) reverse, 5'-

CTCAGGGCCCGCTCATAGTA-3'; OAS 1 forward, 5' -

GGAGGTTGCAGTGCCAACGAAG-3'; OAS 1 reverse, 5'-

TGGAAGGGAGGCAGGGCATAAC-3';

<received> Style tag for received and accepted dates (omit if these are unknown).

Reference:

Fire, A. et al. Potent and specific genetic interference by double-stranded RNA
in Caenorhabditis elegans. Nature 391, 806-11 (1998).

Kim, D. H. & Rossi, J. J. Strategies for silencing human disease using RNA
interference. Nat Rev Genet 8, 173-84 (2007).

Behlke, M. A. Progress towards in vivo use of siRNAs. Mol Ther 13, 644-70
(2006).

Layzer, J. M. et al. In vivo activity of nuclease-resistant siRNAs. Rna 10, 766-71
(2004).

Morrissey, D. V. et al. Activity of stabilized short interfering RNA in a mouse
model of hepatitis B virus replication. Hepatology 41, 1349-56 (2005).

Lewis, D. L. & Wolff, J. A. Delivery of siRNA and siRNA expression
constructs to adult mammals by hydrodynamic intravascular injection. Methods
Enzymol 392, 336-50 (2005).

Kishida, T. et al. Sequence-specific gene silencing in murine muscle induced by
electroporation-mediated transfer of short interfering RNA. J Gene Med 6, 105-
10 (2004).

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

Akaneya, Y., Jiang, B. & Tsumoto, T. RNAi-induced gene silencing by local
electroporation in targeting brain region. J Neurophysiol 93, 594-602 (2005).

Inoue, A. et al. Electro-transfer of small interfering RNA ameliorated arthritis in
rats. Biochem Biophys Res Commun 336, 903-8 (2005).

10.

Tsunoda, S. et al. Sonoporation using microbubble BR14 promotes
pDNA/siRNA transduction to murine heart. Biochem Biophys Res Commun 336,
118-27 (2005).

11.

Kim, T. W. et al. Modification of professional antigen-presenting cells with
small interfering RNA in vivo to enhance cancer vaccine potency. Cancer Res
65, 309-16 (2005).

12.

Soutschek, J. et al. Therapeutic silencing of an endogenous gene by systemic
administration of modified siRNAs. Nature 432, 173-8 (2004).

13.

Hassani, Z. et al. Lipid-mediated siRNA delivery down-regulates exogenous
gene expression in the mouse brain at picomolar levels. J Gene Med 7, 198-207
(2005).

14.

Spagnou, S., Miller, A. D. & Keller, M. Lipidic carriers of siRNA: differences in
the formulation, cellular uptake, and delivery with plasmid DNA. Biochemistry
43, 13348-56 (2004).

15.

Wang, S., Lee, R. J., Cauchon, G., Gorenstein, D. G. & Low, P. S. Delivery of
antisense oligodeoxyribonucleotides against the human epidermal growth factor
receptor into cultured KB cells with liposomes conjugated to folate via
polyethylene glycol. Proc Natl Acad Sci U S A 92, 3318-22 (1995).

16.

Wagner, E., Zenke, M., Cotten, M., Beug, H. & Birnstiel, M. L. Transferrin-
polycation conjugates as carriers for DNA uptake into cells. Proc Natl Acad Sci
U S A 87, 3410-4 (1990).

17.

Schiffelers, R. M. et al. Cancer siRNA therapy by tumor selective delivery with
ligand-targeted sterically stabilized nanoparticle. Nucleic Acids Res 32, e149
(2004).

18.

Pun, S. H. et al. Cyclodextrin-modified polyethylenimine polymers for gene
delivery. Bioconjug Chem 15, 831-40 (2004).

19.

Hu-Lieskovan, S., Heidel, J. D., Bartlett, D. W., Davis, M. E. & Triche, T. J.
Sequence-specific knockdown of EWS-FLI1 by targeted, nonviral delivery of
small interfering RNA inhibits tumor growth in a murine model of metastatic
Ewing's sarcoma. Cancer Res 65, 8984-92 (2005).

20.

Weissleder, R., Kelly, K., Sun, E. Y., Shtatland, T. & Josephson, L. Cell-
specific targeting of nanoparticles by multivalent attachment of small molecules.
Nat Biotechnol 23, 1418-23 (2005).

21.

Sorgi, F. L., Bhattacharya, S. & Huang, L. Protamine sulfate enhances lipid-
mediated gene transfer. Gene Ther 4, 961-8 (1997).

22.

Simeoni, F., Morris, M. C., Heitz, F. & Divita, G. Insight into the mechanism of
the peptide-based gene delivery system MPG: implications for delivery of
siRNA into mammalian cells. Nucleic Acids Res 31, 2717-24 (2003).

23.

Muratovska, A. & Eccles, M. R. Conjugate for efficient delivery of short
interfering RNA (siRNA) into mammalian cells. FEBS Lett 558, 63-8 (2004).

24.

Simeoni, F., Morris, M. C., Heitz, F. & Divita, G. Peptide-based strategy for
siRNA delivery into mammalian cells. Methods Mol Biol 309, 251-60 (2005).

25.

McNamara, J. O., 2nd et al. Cell type-specific delivery of siRNAs with aptamer-
siRNA chimeras. Nat Biotechnol 24, 1005-15 (2006).

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

26.

Chu, T. C., Twu, K. Y., Ellington, A. D. & Levy, M. Aptamer mediated siRNA
delivery. Nucleic Acids Res 34, e73 (2006).

27.

Kwong, P. D. et al. Structure of an HIV gp120 envelope glycoprotein in
complex with the CD4 receptor and a neutralizing human antibody. Nature 393,
648-59 (1998).

28.

Kwong, P. D. et al. Structures of HIV-1 gp120 envelope glycoproteins from
laboratory-adapted and primary isolates. Structure 8, 1329-39 (2000).

29.

Kim, D. H. et al. Synthetic dsRNA Dicer substrates enhance RNAi potency and
efficacy. Nat Biotechnol 23, 222-6 (2005).

30.

Rose, S. D. et al. Functional polarity is introduced by Dicer processing of short
substrate RNAs. Nucleic Acids Res 33, 4140-56 (2005).

31.

Khati, M. et al. Neutralization of infectivity of diverse R5 clinical isolates of
human immunodeficiency virus type 1 by gp120-binding 2'F-RNA aptamers. J
Virol 77, 12692-8 (2003).

32.

Dey, A. K. et al. An aptamer that neutralizes R5 strains of human
immunodeficiency virus type 1 blocks gp120-CCR5 interaction. J Virol 79,
13806-10 (2005).

33.

Dey, A. K., Griffiths, C., Lea, S. M. & James, W. Structural characterization of
an anti-gp120 RNA aptamer that neutralizes R5 strains of HIV-1. Rna 11, 873-
84 (2005).

34.

Czauderna, F. et al. Structural variations and stabilising modifications of
synthetic siRNAs in mammalian cells. Nucleic Acids Res 31, 2705-16 (2003).

35.

Braasch, D. A. et al. RNA interference in mammalian cells by chemically-
modified RNA. Biochemistry 42, 7967-75 (2003).

36.

Morrissey, D. V. et al. Potent and persistent in vivo anti-HBV activity of
chemically modified siRNAs. Nat Biotechnol 23, 1002-7 (2005).

37.

Allerson, C. R. et al. Fully 2'-modified oligonucleotide duplexes with improved
in vitro potency and stability compared to unmodified small interfering RNA. J
Med Chem 48, 901-4 (2005).

38.

Kim, D. H. et al. Interferon induction by siRNAs and ssRNAs synthesized by
phage polymerase. Nat Biotechnol 22, 321-5 (2004).

39.

Schlee, M., Hornung, V. & Hartmann, G. siRNA and isRNA: two edges of one
sword. Mol Ther 14, 463-70 (2006).

40.

Robbins, M. A. et al. Stable expression of shRNAs in human CD34+ progenitor
cells can avoid induction of interferon responses to siRNAs in vitro. Nat
Biotechnol 24, 566-71 (2006).

41.

Ellington, A. D. & Szostak, J. W. In vitro selection of RNA molecules that bind
specific ligands. Nature 346, 818-22 (1990).

42.

Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential
enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249,
505-10 (1990).

43.

Fitzwater, T. & Polisky, B. A SELEX primer. Methods Enzymol 267, 275-301
(1996).

44.

Tuerk, C., MacDougal, S. & Gold, L. RNA pseudoknots that inhibit human
immunodeficiency virus type 1 reverse transcriptase. Proc Natl Acad Sci U S A
89, 6988-92 (1992).

45.

Hicke, B. J. & Stephens, A. W. Escort aptamers: a delivery service for diagnosis
and therapy. J Clin Invest 106, 923-8 (2000).

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

46.

Pestourie, C., Tavitian, B. & Duconge, F. Aptamers against extracellular targets
for in vivo applications. Biochimie 87, 921-30 (2005).

47.

Nimjee, S. M., Rusconi, C. P. & Sullenger, B. A. Aptamers: an emerging class
of therapeutics. Annu Rev Med 56, 555-83 (2005).

48.

Proske, D., Blank, M., Buhmann, R. & Resch, A. Aptamers--basic research,
drug development, and clinical applications. Appl Microbiol Biotechnol 69, 367-
74 (2005).

49.

Weiss, C. D. & White, J. M. Characterization of stable Chinese hamster ovary
cells expressing wild-type, secreted, and glycosylphosphatidylinositol-anchored
human immunodeficiency virus type 1 envelope glycoprotein. J Virol 67, 7060-6
(1993).

50.

Vodicka, M. A. et al. Indicator cell lines for detection of primary strains of
human and simian immunodeficiency viruses. Virology 233, 193-8 (1997).

Supplementary Information accompanies the paper on www.nature.com/nature.

Acknowledgements We thank Daniela Castanotto, Guihua Sun, Harris Soifer, Hoshang Unwalla and

Masayuki Sano for helpful discussions. This work was supported by grants from the National Institutes of

Health awarded to J.J.R. The CHO-EE and CHO-gp160 cell lines

49, 50

and the pNL4-3 luc vector were

obtained from the NIH AIDS Reagent and Repository.

Author information Reprints and permission information is available at

www.nature.com/reprints

. The

authors declare no competing financial interests. Correspondence and requests for materials should be

addressed to J. J. Rossi. (

jrossi@coh.org

)

Figure Legends.

Figure 1: Predicted secondary structure for anti-gp120 aptamer-siRNA chimeras. The region of

anti-gp120 aptamer responsible for binding to gp120 is outlined in green. The siRNA part of the

chimera consists of 27 bps as an example here, targeting Site-I of HIV-1 tat/rev. Two mutated

chimeras M-1 (mutant aptamer) and M-2 (mutant siRNA) were constructed as experimental

controls. Mutated regions are shown in magenta.

Figure 2a: Binding affinity assay. Cy3-labeled RNAs were tested for binding to CHO-gp160

cells and CHO-EE control cells. Cell surface binding of Cy3-labeled aptamer-siRNA chimeras

were assessed by flow cytometry.

Figure 2b: Binding and uptake of Ch 1 to CHO-gp160 cells. CHO-gp160 cells and CHO-EE

control cells were grown on chamber slides and incubated with 20 nM of Ch 1 in culture

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

medium for 2 hours. Cells were washed in PBS three times, fixed and stained with DIO (a

plasma membrane dye), washed and analyzed by confocal microscopy.

Figure 3: Analysis of chimera processing. 21-23 nt RNA fragments are produced following

incubation of chimera RNAs in HCT116 cell extracts. (a) Chimera sense strands were annealed

with equal molar equivalents of 5'-end P

-labeled antisense oligos. (b) The cleavage products

or denatured strands were visualized following denaturing polyacrylamide-gel electrophoresis.

Note that the major Dicer product (marked by a white arrow) of the 27 mer aptamers is

processed from the 5' end of the antisense strand since the 21 base product harbors the 5'

label.

Figure 4a: Aptamer-siRNA chimeras-mediate silencing of pNL4-3 luciferase. CHO-gp160 cells

or CHO-EE cells transfected with pNL4-3 luc were incubated with 200 nM of the experimental

RNAs in the presence or absence of the transfection reagent lipofectamine 2000. In the absence

of the transfection reagent inhibition of pNL4-3 luc expression was only observed for CHO-

gp160 cells. These results are consistent with the aptamer mediated binding to gp160 and

internalization of the chimera followed by processing into siRNAs. The data were normalized

with Renilla luciferase expression and represent the average of three replicate assays.

Figure 4b: Cleaved mRNA from CHO-gp160 cells previously transfected with either saline

(untreated), Tat-Rev site I 27-mer siRNA, 21-mer siRNA, Ch L-1 and Ch L-2 RNAs, was

ligated to an RNA adaptor and reverse transcribed using a gene-specific primer. Depicted is an

agarose gel electorphoresis of the 5'-RACE-PCR amplification products using a primer specific

to the RNA adaptor and a reverse primer (GSP-Rev-2) to Rev-EGFP, indicated specific siRNA-

mediated cleavage products of Rev-EGFP mRNA.

Figure 5a: Northern Blots of infected CEM cells. Infected CEM cells were directly treated with

siRNA and Chimeras. The 27 Chimera RNA is partially processed to a 21 mer siRNA following

uptake into the CEM cells. Total RNAs were hybridized with a 21-mer P

-labeled

oligonucleotide probe. U6 RNA was used as an internal loading control.

Figure 5b: Aptamer-mediated inhibition of expression of tat/rev in infected CEM cells. Cells

were incubated with the wild type aptamer or Ch L-1 for 7 days prior to RNA extraction. Gene

expression for Tat/rev and GAPDH was assayed by qRT-PCR. Data represent the average of

three replicates.

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

Figure 5c: Chimera RNAs inhibit HIV infection. HIV-1 NL4-3 was incubated with the various

RNAs at 37°C for 1 h. Subsequently,the treated virions were used to infect CEM cells. The

culture supernatant was collected at different time (7 d, 11 d, 15 d and 18 d) for p24 antigen

analyses. Data represent the average of duplicate assays.

Figure 5d: The siRNAs delivered by the chimera RNAs inhibit HIV-1 replication in previously

infected CEM cells. 1.5×10

infected CEM cells and 3.5×10

uninfected CEM cells were

incubated at 37C with the various RNAs at a final concentration of 400 nM. The culture

supernatant was collected at different time points (3 d, 5 d, 7 d and 9 d) for p24 antigen

analyses. Data represent the average of triplicate measurements of p24.

Figure 6: IFN assays. IFN-, the interferon response gene encoding P56 (CDKL2) and

OAS1,mRNAs were measured by quantitative RT-PCR. The expression of these interferon

response genes was, not significantly induced by the siRNAs or chimeric RNAs, whereas

expression of these genes was induced by poly(IC) in HEK 293 cells or by IFN-alpha in

infected CEM cells. Gene expression levels are normalized to GAPDH mRNA expression

levels. The data represent the average of triplicate measurements.

Supplementary materials:

Fig S1: Gene silencing activity and strand selectivity of chimera RNAs and siRNAs. Dual

luciferase assays of Renilla luciferase harboring the siRNA targets in the 3' UTR were carried

out using the dual luciferase psiCHECK vector. The siRNA mediated knockdown of sense

(white bars) and anti-sense (gray bars) targets are shown. All RNAs are normalized to the value

of the corresponding buffer control. The strand selectivity was calculated: R

buffer

= 1.0; R

27 mer

siRNA

= 2.2; R

21 mer siRNA

= 4.9; R

Ch L-1

= 3.2; R

Ch L-2

= 1.9; R

Ch 1

= 2.9; R

Ch 2

= 1.6; R

M-2

= 1.2,

respectively.

Fig S2: Confocal microscope images were combined and deconvoluted to reconstruct a three-

dimensional image. Three-dimensional image reconstruction shows localization of the Cy3-

labeled Ch 1 interior to the plasma membrane of a single cell.

Fig S3: RACE PCR sequence.

Figure S4: Immunofluorescence assay of HIV-1 p17. HIV-1 infected CEM cells were incubated

with 400 nM of aptamer or chimeras (Ch L-1 and Ch L-2) in culture media for a) 24 hours and

b) 72 hours. Cells were washed with PBS, fixed, permeabilized and blocked with NGtS. After

incubation with the primary antibody (anti-p17), a FITC-conjugated secondary antibody (Ho-

Mu-FITC) was added to detect the p17 antibody. Cells were washed, resuspended in 15 L hard

mounting medium and spotted on a microscope slide for confocal microscopy imaging.

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

Supplementary materials:

Figure Legends.

Fig S1

: Gene silencing activity and strand selectivity of chimeras RNAs and

siRNA. Dual luciferase assays of psiCHECK sense (white bars) and anti-sense

(gray bars) targets are shown. All RNAs are normalized to the value of the

corresponding buffer control. The strand selectivity was calculated: R

buffer

= 1.0;

27 mer siRNA

= 2.2; R

21 mer siRNA

= 4.9; R

Ch L-1

= 3.2; R

Ch L-2

= 1.9; R

Ch 1

= 2.9; R

Ch 2

= 1.6; R

M-2

= 1.2, respectively.

Fig S2:

Images were combined and deconvoluted to reconstruct a three-

dimensional image. Three-dimensional image reconstruction shows localization

of the Cy3-labeled

Ch 1

in a single cell.

Fig S3

: RACE PCR sequence.

Figure S4

: Immunofluorescence assay of HIV-1 p17. HIV-1 infected CEM cells

were incubated with 400 nM of aptamer or chimeras (

Ch L-1

and

Ch L-2

) in

culture medium for

) 24 hours and

) 72 hours. Cells were washed with PBS,

fixed, permeabilize and block with NGtS. After incubation with primary antibody

(anti-p17), FITC-conjugated secondary antibody (Ho-

-Mu-FITC) was added to

stain cells. Cells were washed, resuspended in 15 L hard mounting medium and

spot on a microscopy slide for confocal microscopy.

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007

Fig S3:

For 27 mer duplex RNA, RACE PCR product was cloned into TA vector and sequenced.

RACE PCR Product exact sequence (243 bp): 5'- GGA CAC TGA CAT GGA CTG AAG

GAG TAG AAA GAG CTC ATC AGA ACA GTC AGA CTG ATC AAG CTT CTC TAT CAA

AGC AAC CCA CCT CCC AAT CCC GAG GGG ACG CGT CAG GCG CGC AGG AAT

AGA AGG CGC CGG TGG AGA GAG AGA CAG AGA CAG ATC CAT TCG ATA TCT

GAA CGG ATC CTT GGC ACT TAT CTG GGA CGA TCT GCA GAG CCT GTG CCT CTT

CAG CTA CCA CCG CTT GAG AGG TTA -3'

For 21 mer duplex RNA, RACE PCR product was gel purified and directly sequenced using

relative forward primer (5'-cDNA primer 1) and reverse primer (GSP primer 2).

RACE PCR Product exact sequence (249 bp):

5'- GGA CAC TGA CAT GGA CTG AAG GAG TAG AAA GAC GAA GAG CTC ATC AGA

ACA GTC AGA CTG ATC AAG CTT CTC TAT CAA AGC AAC CCA CCT CCC AAT CCC

GAG GGG ACG CGT CAG GCG CGC AGG AAT AGA AGG CGC CGG TGG AGA GAG

AGA CAG AGA CAG ATC CAT TCG ATA TCT GAA CGG ATC CTT GGC ACT TAT CTG

GGA CGA TCT GCA GAG CCT GTG CCT CTT CAG CTA CCA CCG CTT GAG AGG TTA -

Nature Precedings : doi:10.1038/npre.2007.1299.1 : Posted 8 Nov 2007