/home/precedings/apps/precedings/shared/storage/document/2007/1290/npre20071290-1

An Olfactory Receptor Pseudogene whose Function emerged in Humans--A case
study in the Evolution of Structure-function in GPCRs

Peter C. Lai

, Gautam Bahl

, Maryse Gremigni

, Valery Matarazzo

, Olivier Clot-

Faybesse

, Catherine Ronin

, and Chiquito J. Crasto

4,5,

Division of Natural Science, Mathematics, and Computing, Bard College at Simon's

Rock, Great Barrington, Massachusetts, USA

Department of Radiology, Wayne State University/ Detroit Medical Center, Detroit,

Michigan, USA.

Laboratoire de Neuroglycobiologie, UMR 6149 CNRS, Université de Provence, Pole

3C, 3 Pl. V.Hugo, 13331-Marseille Cedex 3 France

4,*,

Department of Neurobiology and

Yale Center for Medical Informatics, Yale

University
School of Medicine, New Haven, CT 06516. USA

*Corresponding author

Current Address: Department of Genetics, University of Alabama at Birmingham,
Birmingham, AL 35294; email: ccrasto@genetics.uab.edu; Phone: 205-996-7083; Fax:
205-996-4056-5708

Abstract

Human olfactory receptor, hOR17-210, is identified as a pseudogene in the human

genome. Experimental data has shown however, that the gene product of cloned hOR17-

210 cDNA was able to bind an odorant-binding protein and is narrowly tuned for

excitation by cyclic ketones. Supported by experimental results, we used the

bioinformatics methods of sequence analysis, computational protein modeling and

docking, to show that functionality in this receptor is retained due to sequence-structure

features not previously observed in mammalian ORs. This receptor does not possess the

first two transmembrane helical domains (of seven typically seen in GPCRs). It however,

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

possesses an additional TM that has not been observed in other human olfactory

receptors. By incorporating these novel structural features, we created two putative

models for this receptor. We also docked odor ligands that were experimentally shown to

bind hOR17-210 model. We show how and why structural modifications of OR17-210 do

not hinder this receptor's functionality. Our studies reveal that novel gene rearrangement

that result in sequence and structural diversity in has a bearing on OR and GPCR function

and evolution.

Keywords: Olfactory receptors, functional pseudogene, computational modeling,

docking.

Introduction

GTP-binding Protein Coupled Receptors (GPCRs) are proteins that traduce the cell

membrane and are responsible for catalyzing or initiating a cellular response in the form

of a signal transduction process following an extracellular stimulus.

1,2

GPCR function is

wide and varied. GPCRs are ubiquitously found in mammals, plants and fungi.

Olfactory receptors (OR) constitute the largest gene families in mammalian genomes

Structurally, these entities are believed to be rhodopsin-like GPCRs, characterized by

seven transmembrane helical regions that are connected by three extracellular and three

intracellular loops, an extracellular N-terminus and an intracellular C-terminus. Earlier

experimental observations have shown that there exists a many-many binding/activating

relationship between ORs and odors. One odor may bind and activate more than one OR,

while an OR might be activated by more than one odor.

4-15

Olfactory receptors' (OR)

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

interactions with odorous ligands are widely accepted as the first specific step in the early

events leading to olfactory perception. Research has also suggested that interaction of

odorant ligands with the binding region of an OR

16,17

may cause the receptor to evolve

from a structurally inactive to active state. The olfactory system can differentiate

odorous molecules based on structural and chemical diversity and concentration.

After the publication of the first draft of the human genome, several groups,

working independently, identified the human olfactory repertoire

18-21

. As other

mammalian genomes became available, the OR repertoires of these species were also

identified

22-24

. These genomic OR genes were identified as either putatively functional or

non-functional and pseudogenic. Initially, more than 60% of the human olfactory

receptor genes were flagged as pseudogenes, while that number for the mouse OR

repertoire stands at less than a third.

22,23

As additional analysis is being carried out, the

number of mammalian functional receptors however, is being constantly revised.

25,26

There is evidence that primate evolution is marked by loss of olfactory functionality, as

evidenced by a greater percentage of functional ORs in the evolutionary parent than the

daughter.

OR gene, hOR17-210 was genomically identified as pseudogenic (OR1E3P in the

HUGO and HORDE (Human Olfactory Receptor Database Exploratorium house at

http://bioportal.weizmann.ac.il/HORDE/

) databases. This genomic pseudogene sequence

was identified earlier as possessing a two-nucleotide frame shift

. A cDNA clone of this

frame-shifted sequence was subsequently shown to successfully initiate a G-protein

mediated signal transduction cascade in the presence of a mixture of odorants (especially

ketone compounds

) commonly perceived by humans.

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

We used bioinformatics strategies to show that this receptor protein has sequence-

structure features that are atypical of previously studied ORs or GPCRs. Despite these

differences, this receptor remains functional. The novel sequence-structural features are:

1) hOR17-210 has only six transmembrane helical regions (TMs) instead of the typical

seven. The first two TMs typically observed in models of ORs and GPCRs are missing.

2) While this presumably reduces the number of TMs to five, there exists an additional

TM, which occurs after what is typically observed as the C-terminus in other ORs. The

sequence for this TM is only found in two other ORs--a chimpanzee and a cow homolog,

which themselves have additional unique structural features. 4) The amino acid sequence

motifs for ORs that have been implicated in G-protein coupling and olfactory sensory

neurons targeting

, however, remain structurally and sequentially conserved. 5) Unlike

mammalian ORs and GPCRs studied to date, the C-terminus is predicted to be

extracellular.

We show how and why these structural modifications may not hinder the function

of this OR. We created two putative computational models of this receptor. Our models

incorporate the novel sequence-structural features for this OR. We also carried out

computational docking studies using the preferred of the two models with selected odor

ligands that are known to experimentally excite hOR17-210.

Materials and Methods

Sequence Analysis and Transmembrane Domain Prediction

Figure 1a shows the results of a comparative sequence analysis between the

cDNA sequence functionally studied and the pseudogene (OR1E3P) identified

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

from the genome in the HORDE database

. The former is listed in GENBANK

(http://www.ncbi.nih.gov/) under Accession Number AAC99555, the latter,

Accession Number U53583. OR1E3P has a nucleotide sequence in a missing 5'

region located upstream from the cloned cDNA sequence. The missing region is

as follows:

ATGATGAAGA AGAACCAAAC CATGATCTCA GAGTTCCTGC
TCCTGGGCCT TCCATCCAAC CTGAGCAGCA GAATCTGTTC
TATGCCTTGT TCTTGGCCGT GTATCTTACC ACCCTCCTGG
GGAACCTCCT CGTCATTGTC CTCATTCGAC TGGACTCCCA
CCTCCAC.

On the other hand, the sequence used in our informatics-based work and which

was shown to be functional possesses the following additional base pairs at the 3'

terminus.

TAGTAGGTGTAGTAAAGTTGATAATGAAATATCACTCTAAA
TCAGTGG CTTAA

When the genomic gene sequences is translated using the TRANSLATE tool

available through Swissprot's Expasy web site

(http://ca.expasy.org/tools/dna.html), OR1E3P (genomic OR17-210) contained

several stop codons (denoted by /) after the first 132 residues. (Figure 1b) The

TRANSLATE program also translates a given nucleotide sequence in three

frames. A two-nucleotide frame shift yielded the same peptide sequence as

AAC99555. The sequence in entry AAC99555, when directly translated yields the

functional OR. The bolded region in Figure 1c shows the cDNA cloned protein

sequence that was used in our analysis and in the experimental functional studies

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

As a prelude to creating our computational model, we used Hidden Markov

Models to predict transmembrane helices in hOR17-210. Figure 2 highlights

regions that are predicted as TMs by two transmembrane prediction algorithms:

TMHMM

and HMMTOP

TM. Both were identified as the best -helical TM

prediction programs in an analysis of over ten such programs

. The figure

shows that both programs agree in their identification of only six TMs and an

extracellular C-terminus (red circles).

We carried out a sequence comparison of hOR17-210 with rat OR I7, Olr266 in

Genbank (Accession Number P23270, Figure 3). OR I7, having been among the

first cloned and identified ORs is also exceptionally well characterized, both

experimentally

and computationally, structurally

36,37

. We use rat I7 here to

represent ORs with structural features that are typical of GPCRs. The I7 TM

regions are highlighted as predicted by both TMHMM and HMMTOP. The

figure shows that I7 has TM1 and 2. Both of these TMs are missing in hOR17-

210; the latter has an additional predicted TM after the C-terminus. We denote

this additional TM as TM7'. Interestingly, the region of TM2 correctly predicted

as a helical TM region for rat I7 is not predicted as a TM in hOR17-210 despite

the apparent sequence similarities. Experiments showed that this region was

indeed extracellular and not a TM

We carried out a comprehensive BLAST search for hOR17-210 against

GENBANK. Sequence identity was found between hOR17-210 and its predicted

chimpanzee and cow (Olr466) OR homologs. Figure 4 shows the results of the

alignment. The TM regions are highlighted. All three sequences possess the

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

TM7' region. The notable difference between the three sequences is that the

predicted chimpanzee and cow homologs lack OR17-210's frame shift mutation

and so have seven intact TMs. And just as in hOR17-210, the cow and

chimpanzee homologs are missing the typically observed TM2.

Constructing a structural model of hOR17-210

We created two computational, structural models of hOR17-210 (Figure 5a and 5b). Our

modeling strategies incorporated the new structural features discussed above. In addition

to using homology modeling strategies

to create our preliminary model, we tested a

new paradigm for rationalizing the hydrophobic nature of the inside of the receptor

(Equation 1). Since the first two TMs were missing, during homology modeling, the first

five TMs of hOR17-210 were positioned in the helical assembly in orientations occupied

by TMs 3, 4, 5, 6 and 7, respectively, in typical ORs. The key challenge however, was the

location of orphaned region, TM 7' which could be packed in either of the spaces

formerly having been occupied by TM 1 or 2.

TM helical regions were predicted by using Hidden Markov Models through the

programs: TMHMM2.0

and HMMTOP2.0

Due to the missing TMs 1 and 2 and the addition of an orphaned TM7', the

secondary structures of helices in positions 3, 4, 5, 6 and 7 were refined by

alignment of the first five regions of hOR17-210 against the previously predicted

secondary structure of rat OR-I7. Each predicted OR helix was aligned to the

center of the homologous helix in the rhodopsin structure, with no gaps. Two

variants of helical packing were explored: in the first variant, the final orphaned

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

helix of hOR17-210 was aligned against helix 2 in rhodopsin; in the second

variant, the last (orphaned) helix of hOR17-210 was aligned against helix 1 in

rhodopsin.

3D models were generated using the homology modeling program, Modeler 8v2

. We used the highest resolution structure (2.2 Å) of dark-adapted bovine

rhodopsin

(Protein Data Bank ID: 1U19) as a template. For the helical

construction, each predicted OR helix was sequentially aligned to the center of the

homologous helix in the rhodopsin structure, with no gaps. Two variants of

helical packing were explored: in the first variant, the final orphaned helix of

hOR17-210 was aligned against helix 2 in rhodopsin; in the second variant, the

last (orphaned) helix of hOR17-210 was aligned against helix 1 in rhodopsin.

Each helix of each variant of the structural model was minimized with typical -

helix H-bond distance constraints using the consistent valence force field (CVFF)

and conjugate gradient algorithm in Accelrys Discover suite of programs

(http://www.accelrys.com/products/insight/). The helices were individually

submerged in water during the energy minimization step to relax helical features

specific to rhodopsin.

The hydrophobic moments at each residue around a helix were calculated using

the following expression:

cos

360

Equation

[1]

where,

is the effective aggregate hydrophobicity at each point around a helical

wheel computed by summing the arc contributions to the hydrophobicity moment

on that residue from all other points along the helical wheel for a given TM. In

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

order to establish the correct frame of reference with respect to the entire helical

assembly for hydrophobic moments derived from this algorithm, these were

initially calculated for the TMs in rhodopsin and subsequently mapped to the

actual rotational orientations within the helical bundle. We observed that in

rhodopsin, that the largest valued residues in TM 1, 3, 4, and 7 pointed toward

the binding pocket; for TM2, the largest pointed away from the binding region;

and for TMs 5 and 6, the largest aggregate hydrophobic moments pointed toward

each other. The hydrophobicities for hOR17-210 were computed and the TM

helices were rotated and oriented using this rationale.

After helix construction and rotation, the helices were used as the input template

into the Modeller software for ab initio assignment of the intra- and extracellular

loop residues. The resulting structure was then rigorously minimized using the

Accelrys Discover program by constraining only the motion of the alpha-carbon

atoms of the protein in order to maintain the integrity of the transmembrane

helices.

Of the two models created, our preferred model is one where TM7' is positioned

in place of TM2. As shown in figure 4, the protein sequences in the chimpanzee and cow

homologs both have strongly predicted TM1s and therefore, in order to maintain the

helical bundle, TM7' would have to be placed in the position typically occupied by TM2.

Ligand docking

We docked eight ligands: beta -ionone, d- and l-camphor, 2- and 6-undecanone, heptanal,

decanal, nonanol and nonanone (ligand positional parameters and those for the two model

variants are available from corresponding author) in the binding pocket of our preferred

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

model of hOR17-210--with the TM7' homology-modeled in the place of missing TM2

Figures 6a (ringed ligands) and 6b (straight chain ligands) show the results of

computational docking. Of these ligands, experimentally, the cyclic ketones show strong

responses, the straight chain ketones show weak responses and the alcohols show no

response at any concentration. (Personal Communications--CR). These docked ligands

vary in length of carbon chain and functional groups (aldehyde, ketone, alcohol and ring

structures). Ligand models were constructed using the InsightII suite of software

(

http://www.accelrys.com/insight/

Ligand conformational energies were minimized using the Discover module in

InsightII. We added hydrogen atoms to our I7 OR model

to create a system of pH 7.0.

Atomic charges were assigned using Consistent Valence Force Field (CVFF). We used

DOCK

41,42

to identify the ideal binding configurations of the ligands in the binding

pocket

of the 17-210 human olfactory receptor model. Using every atom in the OR

model as input for the DMS (Dot Molecular Surface) program

, we calculated a solvent

accessible molecular surface-area for the I7 model; and, DOCK's SPHGEN (SPHere

GENerator) module identified cavity site-points in the receptor. We discarded spheres

that represented cavities on the intracellular side of the receptor; these spheres were

structurally "below" the TM3 and TM4 crossover plane in the model. The GRID module

in DOCK was used to generate force fields and interaction parameters to compute

intermolecular binding. DOCK used spheres that were retained to compute spatial

restraints based on van der Waals interactions. Flexible_Ligand, a module in DOCK,

allowed the modification of torsion angles in the ligand. Figures 6a and 6b show the

docked ligands in the receptor model.

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

Results

The helical regions and the internal and external locations of the intra and extracellular

loops and the N- and C-termini are highlighted in the figure 3, which compares the

sequences of hOR17-210 and rat OR I7, one of the first ORs cloned

, functionally

analyzed

, and modeled

36,37

. The highlighted regions in the I7 sequence in figure 3 are

representative of what is typically known about ORs. Figure 2 shows that both

HMMTOP and TMHMM transmembrane prediction programs agree that for hOR17-210:

1) the region beginning with PMY-- is not a TM, although it is predicted to be the

second TM in most ORs; 2) the region we identify as the orphaned TM, TM 7' exists;

and, 3) the C-terminus of the receptor must be atypically extracellular. TM 7' in OR17-

210 extends past the C-terminus of ORI7. The amino acids of the C-terminus in I7 and

the final intracellular loop (between TM 7 and 7') of OR17-210 are conserved.

The hOR17-210 sequence begins with a MPMY polypeptide region. Typically,

in ORs, the PMY sequence motif marks the beginning of TM 2. HMMs for this

functional hOR17-210 sequence predict however, that the region beginning with PMY

(i.e., MPMYLCLSNLSFSDLCFSSVTM is not a helical TM and is extracellular).

Experimentally, heterologous expression of a FLAG (DYKDDDDK polypeptide

sequence) tagged receptor in insect cells confirmed an extracellular N-terminus

. This

leads us to conclude that hOR17-210 is missing both the first and second TMs when

compared to other mammalian ORs. The hOR17-210 transmembrane regions start from

what would typically be TM3 in other ORs. The "MAYDRY" motif region, a highly

conserved sequence within Class A GPCRs and known to be located at the intracellular

end of this TM, has been shown to be essential for G-protein coupling and the initiation

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

of signal transduction following ligand-binding

30,45,46

. In the case of hOR17-210, the

"MAYDRY" sequence has undergone mutation to MAYHCY; since this TM must be

oriented extracellular to intracellular in order for correct positioning of this conserved

motif, it allows the polarity of the remaining TMs predicted by the HMM to be

determined with certainty.

A sequence similarity search of the TM 7' peptide region

"FVFKIVIVGILPLLNLVGVVKLI," returns only two matches. The first is a

chimpanzee OR (GENBANK Accession Number XP_523775), which is homologous to

hOR17-210; the second is a cow OR (GENBANK Accession Number XP_872923).

HMM of these OR sequences predicts that, in addition to the presence of TM 7', the

polypeptide regions beginning with PMY are also not TM helices. One major difference

is that these two orthologs do, however, possess intact TM 1 helices. (Figure 4)

The constrained polarity of the final TM (TM 7') causes the C-terminus of OR17-

210 to become extracellular. Extracellular C-termini have been predicted in Drosophila

odorant receptors.

The sequence region RNRDMRGNPGQSLQHKENFF is the third

intracellular loop in hOR17-210 (between TM 7 and TM 7'). We carried out a BLAST

search using the above sequence of this loop, focusing the search to return only

sequences for olfactory receptors. From over 2500 results, the "RNRDMRG" region is

strongly conserved (greater than 70% identify and 100% positive matches, where R is

often replaced by K) in the C-termini of most ORs (and is possibly involved in GPCR-G-

protein interactions). hOR17-210 functionality is therefore, not affected by an extra-

cellular C-terminus or the lack of a TM (the absence of TMs 1 and 2).

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

Figures 6a and 6b indicate that all the docked odorous ligands are clustered in the

same spatial region bound by the first four TMs (3, 4, 5 and 6) of hOR17-210. The

numbers in parenthesis indicate the TM numbers for typical ORs. An inspection of the

interior of the receptor, which is modeled using the hydrophobicities determined using

equation [1] indicate that there are no strongly polar residues pointing into the binding

pocket, except His48 on TM1. This residue however, is greater than 10Å away from the

nearest ligand atom. The nearest distances from every side-chain atom within the

receptor's binding pocket to each atom of the docked ligands were calculated. The

closest distance (between 0.8 and 1.5 Å) was for Ala108, specifically between ligand

atoms and the methyl hydrogens in Ala108. Some of the interactions can be considered

to be electrostatic in nature because they are between the ligand carbonyl oxygen and the

Ala108 hydrogen atoms. Possible interactive distances were also observed between

ligands and Phe122 and Cys123. These residues however, belong to the first

extracellular loop, which in our model dips into the binding pocket. The contributions of

these residues however, cannot be ascertained because of the dynamic nature of loop

conformations.

Discussion

We created computational structural models for two possible variants to account

for the atypical nature of the hOR17-210 (Figures 5a and 5b). Such a model, based on

structural template matching (the sequence homology between I7 and rhodopsin is less

than 40%)

10,14

may however, introduce rhodopsin structure-specific biases into the

model. Biases include differences in lengths of loops

and kinks

49,50

in TM helical

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

domains. We attempted to limit the intra-helical biases by allowing each helix to

structure-energetically relax in an aqueous medium individually before assembling the

TM domains.

The first step in any GPCR modeling study is the identification of the TM

regions. TM helices presumably protect the interior of the binding pocket from the

surrounding lipid bilayer, while at the same time, ensuring that the signal-transducing

structural features of the receptor are properly positioned inside and outside the cell.

We aligned the first five TMs of hOR17-210 cloned sequence in the positions occupied

by TMs 3, 4, 5, 6 and 7 of typical ORs, respectively. In each variant, TM 7' occupied the

positions typically occupied by TM 1 and TM2, respectively. Our modeling strategy

ensured that sequentially conserved (and possibly functionally implicated) regions were

positioned as found in typical ORs. TM 7' in the two variants was positioned to maintain

the structural integrity of the TM scaffold while protecting the interior of the OR and the

odor ligand. We have indicated earlier that orthologs of hOR17-210 exist in cow and

chimpanzee. Evidence of sequence predicted as TM7' and absence of TM2 in observed in

only these three mammalian ORs. During hOR17-210 modeling, when presented with a

choice of positioning TM7' in the position of TM1 or TM2, we posit that since the cow

and chimpanzee orthologs retained TM1 and were missing only the typical TM2, the

orphaned TM7' would favorably occupy in the position of TM2. (Figure 5b). For

olfactory function to persist, the main GPCR scaffold needs to be maintained.

Katada et al.

have shown that the C-termini of ORs are involved in G-protein

interactions. Our BLAST results have shown that the third intra-cellular loop shows

strong sequence homology with several hundred vertebrate ORs, especially in the

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

"RNRDMRG" sequence motif, which is invariably in the C-terminus, specifically, in the

region where the seventh TM ends and the C-terminus begins. A few of the more than

900 results also show homology in the rest of this intra-cellular loop and the homolgous

ORs are always in the C-terminus. This indicates to us that if a certain motif of amino

acids interacts with the G-protein, then this motif is present in OR17-210 intracellularly.

We conclude therefore that OR function is not hindered because of the presence of an

intracellular third loop.

An extracellular C-terminus for mammalian ORs has also not been experimentally

shown. The presence of an orphaned TM puts the C-terminus extracellularly. This is

confirmed by two TM prediction programs. Experiments involving the attachment of a

poly-Histidine tag to the end of the OR would confirm the extracellular C-terminus for

hOR17-210.

Identifying the active and inactive states for an OR and elucidating its role in

olfaction at a molecular level necessitates an experimental determination of its protein

structure, in addition to knowledge of its odorant repertoire. There is currently, no

experimentally derived structure of an olfactory receptor. This lack of a structure

engenders the assumption that GPCRs are structurally similar to rhodopsin. Every

computational study of olfactory receptors and other GPCRs uses a rhodopsin structure

(the x-ray derived structure with the highest resolution

as used in our modeling here or

a lower resolution electron diffraction structure

). Modifications to remove rhodopsin-

specific biases as detailed in the Materials and Methods section begin from this point.

Computational modeling, docking and simulation studies

15,36,37,53

have shown

that the OR binding region is on the extracellular side--a pocket that is created by side

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

chains belonging to TM regions 3, 4 5 and 6--which is confirmed by our docking results.

Our docking results indicate that the ALA108 is the only residue in the binding pocket

that is within Van der Waals distances with the ligands. These docking results are

preliminary at best. Since all the odors docked in the same general area of the binding

region, we believe that the binding region is apt for odor-OR interactions. We have

previously shown that dynamic simulation of odorous molecules in the olfactory receptor

binding pocket provide instances of interactions with key amino acid residues in the

binding pocket. These interactions are however, not always observed as a result of static

docking. The time and computational effort required to complete the dynamic simulation

of all odors identified that excite hOR17-210 strongly make it the subject of another

paper. Certainly, site-directed mutagenesis results would provide us with better starting

points in our docking and simulation studies. These results unfortunately, do not exist for

this receptor.

Our standard model building protocols differ slightly from those previously

established

36,53,54

, by independently predicting the TM regions followed by removing of

rhodopsin structure specific biases. In the case of hOR17-210, we are breaking new

ground because we have identified and attempt to model a novel TM (TM 7') that has not

been sequence-structurally observed. Once TM 7' was placed in position of TM2 (our

preferred structure), it was subject to the same TM-modeling protocol as other TMs in

our model. Further validation of the novel method we introduced with equation [1] of

calculating hydrophobic moments for determining TM rotations would also be aided by

future experimental work followed by fine tuning of our modeling strategies.

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

Future work with experimental functional analyses following key point mutations

would aid in identifying the role of binding pocket residues in ligand interactions.

Simulating the dynamic motion of ligand in the OR binding pocket where its interactions

with key residues in the binding pocket can vary over the time period of the simulation

would be useful to identify if other residues are involved in the ligand-OR interaction.

Also, computational docking shows that ligands tested (Figures 6a-b) are clustered within

a single region, we can only surmise from the docking results that this region is the

preferred binding region for this OR..

Conclusion

This informatics-based study, supported by experimental results, identifies an OR

possessing atypical sequence-structure features while still maintaining olfactory

functionality. The human olfactory repertoire reveals that the ratio of functional ORs to

pseudogenes is 1:2 (

http://senselab.med.yale.edu/senselab/ORDB/humanOR.html

). This

number has been revised more recently and will be likely revised as more information

becomes available and more genome level experiments are carried out.

Evolutionarily, hOR17-210 could occupy a position of transition between

functional and pseudogenic ORs. This receptor is a possible illustration of how loss in

OR function may occur, namely, through mutations that create unfavorable sequences for

transmembrane helical assembly. Our study, we hope, will cause researchers to reassess

the sequence-structure-function correlates in olfactory receptors, and also the necessity to

incorporate structural features in the classification of ORs and GPCRs.

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

We have used bioinformatics methods to show how and why a receptor appearing

pseudogenic in several portions of the population can be functional in others.

Functionality was confirmed by measuring the experimental, varying excitatory

responses to odor ligands with different of functional groups. While hOR17-210 appears

to lack the first two TMs typically observed in ORs, it possesses an additional TM

present in only two other non-human olfactory receptors in all of GenBank. This TM,

named TM 7', may preserve olfactory function within this OR (when functional) by

maintaining the TM structure, thus protecting the binding odor ligand. The intracellular

positions of regions identified as possibly responsible for olfactory function, due to their

highly conserved nature, are preserved. hOR17-210 possibly straddles the point in

mammalian OR evolution where loss of function occurs.

Bibliography

Ji, T.H., Grossmann, M. & Ji, I. G protein-coupled receptors. I. Diversity of
receptor-ligand interactions. J Biol Chem 273, 17299-302 (1998).

Muller, G. Towards 3D structures of G protein-coupled receptors: a
multidisciplinary approach. Curr Med Chem 7, 861-88 (2000).

King, N., Hittinger, C.T. & Carroll, S.B. Evolution of key cell signaling and
adhesion protein families predates animal origins. Science 301, 361-3 (2003).

Mombaerts, P. Molecular biology of odorant receptors in vertebrates. Annu Rev
Neurosci 22, 487-509 (1999).

Malnic, B., Hirono, J., Sato, T. & Buck, L.B. Combinatorial receptor codes for
odors. Cell 96, 713-23 (1999).

Touhara, K. et al. Functional identification and reconstitution of an odorant
receptor in single olfactory neurons. Proc Natl Acad Sci U S A 96, 4040-5 (1999).

Abaffy, T., Malhotra, A. & Luetje, C.W. The molecular basis for ligand
specificity in a mouse olfactory receptor: a network of functionally important
residues. J Biol Chem 282, 1216-24 (2007).

Bozza, T., Feinstein, P., Zheng, C. & Mombaerts, P. Odorant receptor expression
defines functional units in the mouse olfactory system. J Neurosci 22, 3033-43
(2002).

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

Bruch, R.C. & Rulli, R.D. Ligand binding specificity of a neutral L-amino acid
olfactory receptor. Comp Biochem Physiol B 91, 535-40 (1988).

10.

Katada, S., Hirokawa, T., Oka, Y., Suwa, M. & Touhara, K. Structural basis for a
broad but selective ligand spectrum of a mouse olfactory receptor: mapping the
odorant-binding site.

J Neurosci 25, 1806-15 (2005).

11.

Mombaerts, P. Targeting olfaction. Curr Opin Neurobiol 6, 481-6 (1996).

12.

Mombaerts, P. Odorant receptor gene choice in olfactory sensory neurons: the one
receptor-one neuron hypothesis revisited. Curr Opin Neurobiol 14, 31-6 (2004).

13.

Oka, Y., Omura, M., Kataoka, H. & Touhara, K. Olfactory receptor antagonism
between odorants. Embo J 23, 120-6 (2004).

14.

Rothman, A., Feinstein, P., Hirota, J. & Mombaerts, P. The promoter of the
mouse odorant receptor gene M71. Mol Cell Neurosci 28, 535-46 (2005).

15.

Touhara, K. Odor discrimination by G protein-coupled olfactory receptors.
Microsc Res Tech 58, 135-41 (2002).

16.

Shepherd, G.M. The cognitive neurosciences. in The Cognitive Neurosciences: A
Handbook for the Field (eds. Gazzaniga, M.S. & Bizzi, E.) 105-102 (MIT Press,
Cambridge, Mass., 1995).

17.

Buck, L.B. Information coding in the vertebrate olfactory system. Annu Rev
Neurosci 19, 517-44 (1996).

18.

Glusman, G., Yanai, I., Rubin, I. & Lancet, D. The complete human olfactory
subgenome. Genome Res 11, 685-702 (2001).

19.

Niimura, Y. & Nei, M. Evolution of olfactory receptor genes in the human
genome. Proc Natl Acad Sci U S A 100, 12235-40 (2003).

20.

Malnic, B., Godfrey, P.A. & Buck, L.B. The human olfactory receptor gene
family. Proc Natl Acad Sci U S A 101, 2584-9 (2004).

21.

Zozulya, S., Echeverri, F. & Nguyen, T. The human olfactory receptor repertoire.
Genome Biol 2, RESEARCH0018 (2001).

22.

Zhang, X. & Firestein, S. The olfactory receptor gene superfamily of the mouse.
Nat Neurosci 5, 124-33 (2002).

23.

Young, J.M. et al. Odorant receptor expressed sequence tags demonstrate
olfactory expression of over 400 genes, extensive alternate splicing and unequal
expression levels. Genome Biol 4, R71 (2003).

24.

Quignon, P. et al. The dog and rat olfactory receptor repertoires. Genome Biol 6,
R83 (2005).

25.

Niimura, Y. & Nei, M. Comparative evolutionary analysis of olfactory receptor
gene clusters between humans and mice. Gene 346, 13-21 (2005).

26.

Niimura, Y. & Nei, M. Extensive gains and losses of olfactory receptor genes in
Mammalian evolution. PLoS ONE 2, e708 (2007).

27.

Sharon, D. et al. Primate evolution of an olfactory receptor cluster: diversification
by gene conversion and recent emergence of pseudogenes. Genomics 61, 24-36
(1999).

28.

Menashe, I., Man, O., Lancet, D. & Gilad, Y. Population differences in haplotype
structure within a human olfactory receptor gene cluster. Hum Mol Genet 11,
1381-90 (2002).

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

29.

Matarazzo, V. et al. Functional characterization of two human olfactory receptors
expressed in the baculovirus Sf9 insect cell system. Chem Senses 30, 195-207
(2005).

30.

Imai, T., Suzuki, M. & Sakano, H. Odorant receptor-derived cAMP signals direct
axonal targeting.

Science 314, 657-61 (2006).

31.

Fuchs, T., Glusman, G., Horn-Saban, S., Lancet, D. & Pilpel, Y. The human
olfactory subgenome: from sequence to structure and evolution. Hum Genet 108,
1-13 (2001).

32.

Visiers, I., Ballesteros, J.A. & Weinstein, H. Three-dimensional representations of
G protein-coupled receptor structures and mechanisms. Methods Enzymol 343,
329-71 (2002).

33.

Tusnady, G.E. & Simon, I. The HMMTOP transmembrane topology prediction
server. Bioinformatics 17, 849-50 (2001).

34.

Moller, S., Vilo, J. & Croning, M.D. Prediction of the coupling specificity of G
protein coupled receptors to their G proteins. Bioinformatics 17 Suppl 1, S174-81
(2001).

35.

Araneda, R.C., Kini, A.D. & Firestein, S. The molecular receptive range of an
odorant receptor. Nat Neurosci 3, 1248-55 (2000).

36.

Singer, M.S. Analysis of the molecular basis for octanal interactions in the
expressed rat 17 olfactory receptor. Chem Senses 25, 155-65 (2000).

37.

Lai, P.C., Singer, M.S. & Crasto, C.J. Structural activation pathways from
dynamic olfactory receptor-odorant interactions. Chem Senses 30, 781-92 (2005).

38.

John, B. & Sali, A. Comparative protein structure modeling by iterative
alignment, model building and model assessment. Nucleic Acids Res 31, 3982-92
(2003).

39.

Melen, K., Krogh, A. & von Heijne, G. Reliability measures for membrane
protein topology prediction algorithms. J Mol Biol 327, 735-44 (2003).

40.

Okada, T. X-ray crystallographic studies for ligand-protein interaction changes in
rhodopsin. Biochem Soc Trans 32, 738-41 (2004).

41.

Gschwend, D.A., Good, A.C. & Kuntz, I.D. Molecular docking towards drug
discovery. J Mol Recognit 9, 175-86 (1996).

42.

Gschwend, D.A. & Kuntz, I.D. Orientational sampling and rigid-body
minimization in molecular docking revisited: on-the-fly optimization and
degeneracy removal. J Comput Aided Mol Des 10, 123-32 (1996).

43.

Richards, F.M. Areas, volumes, packing and protein structure. Annu Rev Biophys
Bioeng 6, 151-76 (1977).

44.

Buck, L. & Axel, R. A novel multigene family may encode odorant receptors: a
molecular basis for odor recognition. Cell 65, 175-87 (1991).

45.

Burger, M. et al. Point mutation causing constitutive signaling of CXCR2 leads to
transforming activity similar to Kaposi's sarcoma herpesvirus-G protein-coupled
receptor. J Immunol 163, 2017-22 (1999).

46.

Scheer, A., Fanelli, F., Costa, T., De Benedetti, P.G. & Cotecchia, S.
Constitutively active mutants of the alpha 1B-adrenergic receptor: role of highly
conserved polar amino acids in receptor activation. Embo J 15, 3566-78 (1996).

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

47.

Benton, R., Sachse, S., Michnick, S.W. & Vosshall, L.B. Atypical membrane
topology and heteromeric function of Drosophila odorant receptors in vivo. PLoS
Biol 4, e20 (2006).

48.

Otaki, J.M. & Firestein, S. Length analyses of mammalian G-protein-coupled
receptors.

J Theor Biol 211, 77-100 (2001).

49.

Olender, T., Feldmesser, E., Atarot, T., Eisenstein, M. & Lancet, D. The olfactory
receptor universe - from whole genome analysis to structure and evolution. Genet
Mol Res 3, 545-53 (2004).

50.

Yohannan, S., Faham, S., Yang, D., Whitelegge, J.P. & Bowie, J.U. The evolution
of transmembrane helix kinks and the structural diversity of G protein-coupled
receptors. Proc Natl Acad Sci U S A 101, 959-63 (2004).

51.

Katada, S. & Touhara, K. [A molecular basis for odorant recognition: olfactory
receptor pharmacology]. Nippon Yakurigaku Zasshi 124, 201-9 (2004).

52.

Krebs, A., Villa, C., Edwards, P.C. & Schertler, G.F. Characterisation of an
improved two-dimensional p22121 crystal from bovine rhodopsin. J Mol Biol
282, 991-1003 (1998).

53.

Vaidehi, N. et al. Prediction of structure and function of G protein-coupled
receptors. Proc Natl Acad Sci U S A 99, 12622-7 (2002).

54.

Singer, M.S. & Shepherd, G.M. Molecular modeling of ligand-receptor
interactions in the OR5 olfactory receptor. Neuroreport 5, 1297-300 (1994).

List of Figures

1a) Results of the sequence alignment between OR17-210 cDNA found in GENBANK
Accession number (AAC99555) and OR1e3P genomic DNA found in the HORDE
database. The functional region in OR17-210 begins from nucleotide 170. This is caused
by a two-residue frame shift in the genomic DNA. The sequence of the functional
protein also contains an added region beginning from nucleotide number 977. This
orphan TM 7' and the extracellular C-termini are contained in this region. The frame
shift results in a stop codon beyond nucleotide 1030.

1b) Results of the translation of the genomic DNA for Or1e3P as found in the HORDE
database. The presence of stop codons indicates that the receptor is pseudogenic as
listed.

1c) Results of the translation of the genomic DNA of OR1e3P as found in the HORDE
database, but following a 2-nucleotide frame shift. This sequence is however, is missing
the 3' region that resulted in the orphan TM observed in ACC99555 (the sequence used
in the functional studies).

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007

2. Figure shows the results of Hidden Markov Model predictions of termini, intra and
extra-cellular loops in hOR17-210. Two different profiling programs were used,
TMHMM and HMMTOP. The yellow highlighted regions show the predicted TM
helices. The blue colored regions indicate the extra-cellular N-termini which contains
MPMY polypeptide motif, which marks the beginning of TM2 in most ORs. The region
last highlighted region is the orphan TM 7' region. The red colored region shows that the
C-terminus of this protein is extracellular.

3. Figure shows the results of a sequence alignment with rat I7, here represented as a
typical olfactory receptor, and hOR17-210. The highlighted regions indicating the TM
domains assigned to the model show that 17-210 lacks TMs 1 and 2, that the MPMY
region is extracellular. It shows alignment between TM1 of hOR17-210 and I7, with the
HCY of OR17-210 and the DRY of I7 aligned in the intracellular loop. The figure also
shows strong alignment between the third intracellular loop of OR17-210 and the C-
terminus of I7, before the origination of TM 7' in OR17-210. Yellow segments show
final TM helical assignments used in the models.

4. Figure shows the results of sequence alignment of hOR17-210, its predicted
chimpanzee homolog and predicted OR in cow (Orl466-homolog). Each OR shows
atypical features of the polypeptide region beginning with PMY not being a TM, and the
existence of a TM 7'. Additionally, the chimpanzee and the cow OR gene products show
the existence of a TM 1. Residues highlighted in yellow are regions predicted by
TMHMM to be transmembrane domains.

5a: Figure shows a structural model for OR17-210 with the TM 7' occupying the position

typically occupied by TM 1 in rhodopsin-like GPCRs.

5b: Figure shows a structural model for OR17-210 with the TM 7' occupying the position
typically occupied by TM 2 in rhodopsin-like GPCRs.

6a: Figure shows the docking of three ligands with ring structures: beta ionone (green),
D-camphor (yellow) and L-camphor (pink). The figure shows the proximity of the
docked ligands to ALA108 in white. The binding is expectedly in the region bound by
TMs 3 (1), 4 (2), 5(3) and 6(4). The TM identifiers are numbers typical of ORs and
GPCRs. The numbers in parentheses are TM numbers for hOR17-210.

6b: Figure shows the docking of five ligands straight chains: decanol (yellow),
nonanone(green), nonanol (pink), 2-undecanone (orange) and 6-undecanone (white). The
figure shows the proximity of the docked ligands to ALA108 in white. The binding is

Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007