An Olfactory Receptor Pseudogene whose Function emerged in Humans--A case
study in the Evolution of Structure-function in GPCRs
Peter C. Lai
1
, Gautam Bahl
2
, Maryse Gremigni
3
, Valery Matarazzo
3
, Olivier Clot-
Faybesse
3
, Catherine Ronin
3
, and Chiquito J. Crasto
4,5,
*,
1
Division of Natural Science, Mathematics, and Computing, Bard College at Simon's
Rock, Great Barrington, Massachusetts, USA
2
Department of Radiology, Wayne State University/ Detroit Medical Center, Detroit,
Michigan, USA.
3
Laboratoire de Neuroglycobiologie, UMR 6149 CNRS, Université de Provence, Pole
3C, 3 Pl. V.Hugo, 13331-Marseille Cedex 3 France
4,*,
Department of Neurobiology and
5
Yale Center for Medical Informatics, Yale
University
School of Medicine, New Haven, CT 06516. USA
*Corresponding author
Current Address: Department of Genetics, University of Alabama at Birmingham,
Birmingham, AL 35294; email: ccrasto@genetics.uab.edu; Phone: 205-996-7083; Fax:
205-996-4056-5708
Abstract
Human olfactory receptor, hOR17-210, is identified as a pseudogene in the human
genome. Experimental data has shown however, that the gene product of cloned hOR17-
210 cDNA was able to bind an odorant-binding protein and is narrowly tuned for
excitation by cyclic ketones. Supported by experimental results, we used the
bioinformatics methods of sequence analysis, computational protein modeling and
docking, to show that functionality in this receptor is retained due to sequence-structure
features not previously observed in mammalian ORs. This receptor does not possess the
first two transmembrane helical domains (of seven typically seen in GPCRs). It however,
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
possesses an additional TM that has not been observed in other human olfactory
receptors. By incorporating these novel structural features, we created two putative
models for this receptor. We also docked odor ligands that were experimentally shown to
bind hOR17-210 model. We show how and why structural modifications of OR17-210 do
not hinder this receptor's functionality. Our studies reveal that novel gene rearrangement
that result in sequence and structural diversity in has a bearing on OR and GPCR function
and evolution.
Keywords: Olfactory receptors, functional pseudogene, computational modeling,
docking.
Introduction
GTP-binding Protein Coupled Receptors (GPCRs) are proteins that traduce the cell
membrane and are responsible for catalyzing or initiating a cellular response in the form
of a signal transduction process following an extracellular stimulus.
1,2
GPCR function is
wide and varied. GPCRs are ubiquitously found in mammals, plants and fungi.
3
Olfactory receptors (OR) constitute the largest gene families in mammalian genomes
4
.
Structurally, these entities are believed to be rhodopsin-like GPCRs, characterized by
seven transmembrane helical regions that are connected by three extracellular and three
intracellular loops, an extracellular N-terminus and an intracellular C-terminus. Earlier
experimental observations have shown that there exists a many-many binding/activating
relationship between ORs and odors. One odor may bind and activate more than one OR,
while an OR might be activated by more than one odor.
4-15
Olfactory receptors' (OR)
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
interactions with odorous ligands are widely accepted as the first specific step in the early
events leading to olfactory perception. Research has also suggested that interaction of
odorant ligands with the binding region of an OR
16,17
may cause the receptor to evolve
from a structurally inactive to active state. The olfactory system can differentiate
odorous molecules based on structural and chemical diversity and concentration.
After the publication of the first draft of the human genome, several groups,
working independently, identified the human olfactory repertoire
18-21
. As other
mammalian genomes became available, the OR repertoires of these species were also
identified
22-24
. These genomic OR genes were identified as either putatively functional or
non-functional and pseudogenic. Initially, more than 60% of the human olfactory
receptor genes were flagged as pseudogenes, while that number for the mouse OR
repertoire stands at less than a third.
22,23
As additional analysis is being carried out, the
number of mammalian functional receptors however, is being constantly revised.
25,26
There is evidence that primate evolution is marked by loss of olfactory functionality, as
evidenced by a greater percentage of functional ORs in the evolutionary parent than the
daughter.
27
OR gene, hOR17-210 was genomically identified as pseudogenic (OR1E3P in the
HUGO and HORDE (Human Olfactory Receptor Database Exploratorium house at
http://bioportal.weizmann.ac.il/HORDE/
) databases. This genomic pseudogene sequence
was identified earlier as possessing a two-nucleotide frame shift
28
. A cDNA clone of this
frame-shifted sequence was subsequently shown to successfully initiate a G-protein
mediated signal transduction cascade in the presence of a mixture of odorants (especially
ketone compounds
29
) commonly perceived by humans.
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
We used bioinformatics strategies to show that this receptor protein has sequence-
structure features that are atypical of previously studied ORs or GPCRs. Despite these
differences, this receptor remains functional. The novel sequence-structural features are:
1) hOR17-210 has only six transmembrane helical regions (TMs) instead of the typical
seven. The first two TMs typically observed in models of ORs and GPCRs are missing.
2) While this presumably reduces the number of TMs to five, there exists an additional
TM, which occurs after what is typically observed as the C-terminus in other ORs. The
sequence for this TM is only found in two other ORs--a chimpanzee and a cow homolog,
which themselves have additional unique structural features. 4) The amino acid sequence
motifs for ORs that have been implicated in G-protein coupling and olfactory sensory
neurons targeting
30
, however, remain structurally and sequentially conserved. 5) Unlike
mammalian ORs and GPCRs studied to date, the C-terminus is predicted to be
extracellular.
We show how and why these structural modifications may not hinder the function
of this OR. We created two putative computational models of this receptor. Our models
incorporate the novel sequence-structural features for this OR. We also carried out
computational docking studies using the preferred of the two models with selected odor
ligands that are known to experimentally excite hOR17-210.
29
Materials and Methods
Sequence Analysis and Transmembrane Domain Prediction
Figure 1a shows the results of a comparative sequence analysis between the
cDNA sequence functionally studied and the pseudogene (OR1E3P) identified
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
from the genome in the HORDE database
31
. The former is listed in GENBANK
(http://www.ncbi.nih.gov/) under Accession Number AAC99555, the latter,
Accession Number U53583. OR1E3P has a nucleotide sequence in a missing 5'
region located upstream from the cloned cDNA sequence. The missing region is
as follows:
ATGATGAAGA AGAACCAAAC CATGATCTCA GAGTTCCTGC
TCCTGGGCCT TCCATCCAAC CTGAGCAGCA GAATCTGTTC
TATGCCTTGT TCTTGGCCGT GTATCTTACC ACCCTCCTGG
GGAACCTCCT CGTCATTGTC CTCATTCGAC TGGACTCCCA
CCTCCAC.
On the other hand, the sequence used in our informatics-based work and which
was shown to be functional possesses the following additional base pairs at the 3'
terminus.
TAGTAGGTGTAGTAAAGTTGATAATGAAATATCACTCTAAA
TCAGTGG CTTAA
When the genomic gene sequences is translated using the TRANSLATE tool
available through Swissprot's Expasy web site
(http://ca.expasy.org/tools/dna.html), OR1E3P (genomic OR17-210) contained
several stop codons (denoted by /) after the first 132 residues. (Figure 1b) The
TRANSLATE program also translates a given nucleotide sequence in three
frames. A two-nucleotide frame shift yielded the same peptide sequence as
AAC99555. The sequence in entry AAC99555, when directly translated yields the
functional OR. The bolded region in Figure 1c shows the cDNA cloned protein
sequence that was used in our analysis and in the experimental functional studies
29
.
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
As a prelude to creating our computational model, we used Hidden Markov
Models to predict transmembrane helices in hOR17-210. Figure 2 highlights
regions that are predicted as TMs by two transmembrane prediction algorithms:
TMHMM
32
and HMMTOP
33
TM. Both were identified as the best -helical TM
prediction programs in an analysis of over ten such programs
34
. The figure
shows that both programs agree in their identification of only six TMs and an
extracellular C-terminus (red circles).
We carried out a sequence comparison of hOR17-210 with rat OR I7, Olr266 in
Genbank (Accession Number P23270, Figure 3). OR I7, having been among the
first cloned and identified ORs is also exceptionally well characterized, both
experimentally
35
and computationally, structurally
36,37
. We use rat I7 here to
represent ORs with structural features that are typical of GPCRs. The I7 TM
regions are highlighted as predicted by both TMHMM and HMMTOP. The
figure shows that I7 has TM1 and 2. Both of these TMs are missing in hOR17-
210; the latter has an additional predicted TM after the C-terminus. We denote
this additional TM as TM7'. Interestingly, the region of TM2 correctly predicted
as a helical TM region for rat I7 is not predicted as a TM in hOR17-210 despite
the apparent sequence similarities. Experiments showed that this region was
indeed extracellular and not a TM
29
.
We carried out a comprehensive BLAST search for hOR17-210 against
GENBANK. Sequence identity was found between hOR17-210 and its predicted
chimpanzee and cow (Olr466) OR homologs. Figure 4 shows the results of the
alignment. The TM regions are highlighted. All three sequences possess the
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
TM7' region. The notable difference between the three sequences is that the
predicted chimpanzee and cow homologs lack OR17-210's frame shift mutation
and so have seven intact TMs. And just as in hOR17-210, the cow and
chimpanzee homologs are missing the typically observed TM2.
Constructing a structural model of hOR17-210
We created two computational, structural models of hOR17-210 (Figure 5a and 5b). Our
modeling strategies incorporated the new structural features discussed above. In addition
to using homology modeling strategies
38
to create our preliminary model, we tested a
new paradigm for rationalizing the hydrophobic nature of the inside of the receptor
(Equation 1). Since the first two TMs were missing, during homology modeling, the first
five TMs of hOR17-210 were positioned in the helical assembly in orientations occupied
by TMs 3, 4, 5, 6 and 7, respectively, in typical ORs. The key challenge however, was the
location of orphaned region, TM 7' which could be packed in either of the spaces
formerly having been occupied by TM 1 or 2.
·
TM helical regions were predicted by using Hidden Markov Models through the
programs: TMHMM2.0
39
and HMMTOP2.0
33
.
·
Due to the missing TMs 1 and 2 and the addition of an orphaned TM7', the
secondary structures of helices in positions 3, 4, 5, 6 and 7 were refined by
alignment of the first five regions of hOR17-210 against the previously predicted
secondary structure of rat OR-I7. Each predicted OR helix was aligned to the
center of the homologous helix in the rhodopsin structure, with no gaps. Two
variants of helical packing were explored: in the first variant, the final orphaned
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
helix of hOR17-210 was aligned against helix 2 in rhodopsin; in the second
variant, the last (orphaned) helix of hOR17-210 was aligned against helix 1 in
rhodopsin.
·
3D models were generated using the homology modeling program, Modeler 8v2
38
. We used the highest resolution structure (2.2 Å) of dark-adapted bovine
rhodopsin
40
(Protein Data Bank ID: 1U19) as a template. For the helical
construction, each predicted OR helix was sequentially aligned to the center of the
homologous helix in the rhodopsin structure, with no gaps. Two variants of
helical packing were explored: in the first variant, the final orphaned helix of
hOR17-210 was aligned against helix 2 in rhodopsin; in the second variant, the
last (orphaned) helix of hOR17-210 was aligned against helix 1 in rhodopsin.
·
Each helix of each variant of the structural model was minimized with typical -
helix H-bond distance constraints using the consistent valence force field (CVFF)
and conjugate gradient algorithm in Accelrys Discover suite of programs
(http://www.accelrys.com/products/insight/). The helices were individually
submerged in water during the energy minimization step to relax helical features
specific to rhodopsin.
·
The hydrophobic moments at each residue around a helix were calculated using
the following expression:
i
o
i
cos
.
360
Equation
[1]
where,
is the effective aggregate hydrophobicity at each point around a helical
wheel computed by summing the arc contributions to the hydrophobicity moment
on that residue from all other points along the helical wheel for a given TM. In
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
order to establish the correct frame of reference with respect to the entire helical
assembly for hydrophobic moments derived from this algorithm, these were
initially calculated for the TMs in rhodopsin and subsequently mapped to the
actual rotational orientations within the helical bundle. We observed that in
rhodopsin, that the largest valued residues in TM 1, 3, 4, and 7 pointed toward
the binding pocket; for TM2, the largest pointed away from the binding region;
and for TMs 5 and 6, the largest aggregate hydrophobic moments pointed toward
each other. The hydrophobicities for hOR17-210 were computed and the TM
helices were rotated and oriented using this rationale.
·
After helix construction and rotation, the helices were used as the input template
into the Modeller software for ab initio assignment of the intra- and extracellular
loop residues. The resulting structure was then rigorously minimized using the
Accelrys Discover program by constraining only the motion of the alpha-carbon
atoms of the protein in order to maintain the integrity of the transmembrane
helices.
Of the two models created, our preferred model is one where TM7' is positioned
in place of TM2. As shown in figure 4, the protein sequences in the chimpanzee and cow
homologs both have strongly predicted TM1s and therefore, in order to maintain the
helical bundle, TM7' would have to be placed in the position typically occupied by TM2.
Ligand docking
We docked eight ligands: beta -ionone, d- and l-camphor, 2- and 6-undecanone, heptanal,
decanal, nonanol and nonanone (ligand positional parameters and those for the two model
variants are available from corresponding author) in the binding pocket of our preferred
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
model of hOR17-210--with the TM7' homology-modeled in the place of missing TM2
Figures 6a (ringed ligands) and 6b (straight chain ligands) show the results of
computational docking. Of these ligands, experimentally, the cyclic ketones show strong
responses, the straight chain ketones show weak responses and the alcohols show no
response at any concentration. (Personal Communications--CR). These docked ligands
vary in length of carbon chain and functional groups (aldehyde, ketone, alcohol and ring
structures). Ligand models were constructed using the InsightII suite of software
(
http://www.accelrys.com/insight/
).
Ligand conformational energies were minimized using the Discover module in
InsightII. We added hydrogen atoms to our I7 OR model
36
to create a system of pH 7.0.
Atomic charges were assigned using Consistent Valence Force Field (CVFF). We used
DOCK
41,42
to identify the ideal binding configurations of the ligands in the binding
pocket
36
of the 17-210 human olfactory receptor model. Using every atom in the OR
model as input for the DMS (Dot Molecular Surface) program
43
, we calculated a solvent
accessible molecular surface-area for the I7 model; and, DOCK's SPHGEN (SPHere
GENerator) module identified cavity site-points in the receptor. We discarded spheres
that represented cavities on the intracellular side of the receptor; these spheres were
structurally "below" the TM3 and TM4 crossover plane in the model. The GRID module
in DOCK was used to generate force fields and interaction parameters to compute
intermolecular binding. DOCK used spheres that were retained to compute spatial
restraints based on van der Waals interactions. Flexible_Ligand, a module in DOCK,
allowed the modification of torsion angles in the ligand. Figures 6a and 6b show the
docked ligands in the receptor model.
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Results
The helical regions and the internal and external locations of the intra and extracellular
loops and the N- and C-termini are highlighted in the figure 3, which compares the
sequences of hOR17-210 and rat OR I7, one of the first ORs cloned
44
, functionally
analyzed
35
, and modeled
36,37
. The highlighted regions in the I7 sequence in figure 3 are
representative of what is typically known about ORs. Figure 2 shows that both
HMMTOP and TMHMM transmembrane prediction programs agree that for hOR17-210:
1) the region beginning with PMY-- is not a TM, although it is predicted to be the
second TM in most ORs; 2) the region we identify as the orphaned TM, TM 7' exists;
and, 3) the C-terminus of the receptor must be atypically extracellular. TM 7' in OR17-
210 extends past the C-terminus of ORI7. The amino acids of the C-terminus in I7 and
the final intracellular loop (between TM 7 and 7') of OR17-210 are conserved.
The hOR17-210 sequence begins with a MPMY polypeptide region. Typically,
in ORs, the PMY sequence motif marks the beginning of TM 2. HMMs for this
functional hOR17-210 sequence predict however, that the region beginning with PMY
(i.e., MPMYLCLSNLSFSDLCFSSVTM is not a helical TM and is extracellular).
Experimentally, heterologous expression of a FLAG (DYKDDDDK polypeptide
sequence) tagged receptor in insect cells confirmed an extracellular N-terminus
29
. This
leads us to conclude that hOR17-210 is missing both the first and second TMs when
compared to other mammalian ORs. The hOR17-210 transmembrane regions start from
what would typically be TM3 in other ORs. The "MAYDRY" motif region, a highly
conserved sequence within Class A GPCRs and known to be located at the intracellular
end of this TM, has been shown to be essential for G-protein coupling and the initiation
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
of signal transduction following ligand-binding
30,45,46
. In the case of hOR17-210, the
"MAYDRY" sequence has undergone mutation to MAYHCY; since this TM must be
oriented extracellular to intracellular in order for correct positioning of this conserved
motif, it allows the polarity of the remaining TMs predicted by the HMM to be
determined with certainty.
A sequence similarity search of the TM 7' peptide region
"FVFKIVIVGILPLLNLVGVVKLI," returns only two matches. The first is a
chimpanzee OR (GENBANK Accession Number XP_523775), which is homologous to
hOR17-210; the second is a cow OR (GENBANK Accession Number XP_872923).
HMM of these OR sequences predicts that, in addition to the presence of TM 7', the
polypeptide regions beginning with PMY are also not TM helices. One major difference
is that these two orthologs do, however, possess intact TM 1 helices. (Figure 4)
The constrained polarity of the final TM (TM 7') causes the C-terminus of OR17-
210 to become extracellular. Extracellular C-termini have been predicted in Drosophila
odorant receptors.
47
The sequence region RNRDMRGNPGQSLQHKENFF is the third
intracellular loop in hOR17-210 (between TM 7 and TM 7'). We carried out a BLAST
search using the above sequence of this loop, focusing the search to return only
sequences for olfactory receptors. From over 2500 results, the "RNRDMRG" region is
strongly conserved (greater than 70% identify and 100% positive matches, where R is
often replaced by K) in the C-termini of most ORs (and is possibly involved in GPCR-G-
protein interactions). hOR17-210 functionality is therefore, not affected by an extra-
cellular C-terminus or the lack of a TM (the absence of TMs 1 and 2).
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Figures 6a and 6b indicate that all the docked odorous ligands are clustered in the
same spatial region bound by the first four TMs (3, 4, 5 and 6) of hOR17-210. The
numbers in parenthesis indicate the TM numbers for typical ORs. An inspection of the
interior of the receptor, which is modeled using the hydrophobicities determined using
equation [1] indicate that there are no strongly polar residues pointing into the binding
pocket, except His48 on TM1. This residue however, is greater than 10Å away from the
nearest ligand atom. The nearest distances from every side-chain atom within the
receptor's binding pocket to each atom of the docked ligands were calculated. The
closest distance (between 0.8 and 1.5 Å) was for Ala108, specifically between ligand
atoms and the methyl hydrogens in Ala108. Some of the interactions can be considered
to be electrostatic in nature because they are between the ligand carbonyl oxygen and the
Ala108 hydrogen atoms. Possible interactive distances were also observed between
ligands and Phe122 and Cys123. These residues however, belong to the first
extracellular loop, which in our model dips into the binding pocket. The contributions of
these residues however, cannot be ascertained because of the dynamic nature of loop
conformations.
Discussion
We created computational structural models for two possible variants to account
for the atypical nature of the hOR17-210 (Figures 5a and 5b). Such a model, based on
structural template matching (the sequence homology between I7 and rhodopsin is less
than 40%)
10,14
may however, introduce rhodopsin structure-specific biases into the
model. Biases include differences in lengths of loops
48
and kinks
49,50
in TM helical
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
domains. We attempted to limit the intra-helical biases by allowing each helix to
structure-energetically relax in an aqueous medium individually before assembling the
TM domains.
The first step in any GPCR modeling study is the identification of the TM
regions. TM helices presumably protect the interior of the binding pocket from the
surrounding lipid bilayer, while at the same time, ensuring that the signal-transducing
structural features of the receptor are properly positioned inside and outside the cell.
We aligned the first five TMs of hOR17-210 cloned sequence in the positions occupied
by TMs 3, 4, 5, 6 and 7 of typical ORs, respectively. In each variant, TM 7' occupied the
positions typically occupied by TM 1 and TM2, respectively. Our modeling strategy
ensured that sequentially conserved (and possibly functionally implicated) regions were
positioned as found in typical ORs. TM 7' in the two variants was positioned to maintain
the structural integrity of the TM scaffold while protecting the interior of the OR and the
odor ligand. We have indicated earlier that orthologs of hOR17-210 exist in cow and
chimpanzee. Evidence of sequence predicted as TM7' and absence of TM2 in observed in
only these three mammalian ORs. During hOR17-210 modeling, when presented with a
choice of positioning TM7' in the position of TM1 or TM2, we posit that since the cow
and chimpanzee orthologs retained TM1 and were missing only the typical TM2, the
orphaned TM7' would favorably occupy in the position of TM2. (Figure 5b). For
olfactory function to persist, the main GPCR scaffold needs to be maintained.
Katada et al.
51
have shown that the C-termini of ORs are involved in G-protein
interactions. Our BLAST results have shown that the third intra-cellular loop shows
strong sequence homology with several hundred vertebrate ORs, especially in the
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
"RNRDMRG" sequence motif, which is invariably in the C-terminus, specifically, in the
region where the seventh TM ends and the C-terminus begins. A few of the more than
900 results also show homology in the rest of this intra-cellular loop and the homolgous
ORs are always in the C-terminus. This indicates to us that if a certain motif of amino
acids interacts with the G-protein, then this motif is present in OR17-210 intracellularly.
We conclude therefore that OR function is not hindered because of the presence of an
intracellular third loop.
An extracellular C-terminus for mammalian ORs has also not been experimentally
shown. The presence of an orphaned TM puts the C-terminus extracellularly. This is
confirmed by two TM prediction programs. Experiments involving the attachment of a
poly-Histidine tag to the end of the OR would confirm the extracellular C-terminus for
hOR17-210.
Identifying the active and inactive states for an OR and elucidating its role in
olfaction at a molecular level necessitates an experimental determination of its protein
structure, in addition to knowledge of its odorant repertoire. There is currently, no
experimentally derived structure of an olfactory receptor. This lack of a structure
engenders the assumption that GPCRs are structurally similar to rhodopsin. Every
computational study of olfactory receptors and other GPCRs uses a rhodopsin structure
(the x-ray derived structure with the highest resolution
40
as used in our modeling here or
a lower resolution electron diffraction structure
52
). Modifications to remove rhodopsin-
specific biases as detailed in the Materials and Methods section begin from this point.
Computational modeling, docking and simulation studies
15,36,37,53
have shown
that the OR binding region is on the extracellular side--a pocket that is created by side
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
chains belonging to TM regions 3, 4 5 and 6--which is confirmed by our docking results.
Our docking results indicate that the ALA108 is the only residue in the binding pocket
that is within Van der Waals distances with the ligands. These docking results are
preliminary at best. Since all the odors docked in the same general area of the binding
region, we believe that the binding region is apt for odor-OR interactions. We have
previously shown that dynamic simulation of odorous molecules in the olfactory receptor
binding pocket provide instances of interactions with key amino acid residues in the
binding pocket. These interactions are however, not always observed as a result of static
docking. The time and computational effort required to complete the dynamic simulation
of all odors identified that excite hOR17-210 strongly make it the subject of another
paper. Certainly, site-directed mutagenesis results would provide us with better starting
points in our docking and simulation studies. These results unfortunately, do not exist for
this receptor.
Our standard model building protocols differ slightly from those previously
established
36,53,54
, by independently predicting the TM regions followed by removing of
rhodopsin structure specific biases. In the case of hOR17-210, we are breaking new
ground because we have identified and attempt to model a novel TM (TM 7') that has not
been sequence-structurally observed. Once TM 7' was placed in position of TM2 (our
preferred structure), it was subject to the same TM-modeling protocol as other TMs in
our model. Further validation of the novel method we introduced with equation [1] of
calculating hydrophobic moments for determining TM rotations would also be aided by
future experimental work followed by fine tuning of our modeling strategies.
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Future work with experimental functional analyses following key point mutations
would aid in identifying the role of binding pocket residues in ligand interactions.
Simulating the dynamic motion of ligand in the OR binding pocket where its interactions
with key residues in the binding pocket can vary over the time period of the simulation
would be useful to identify if other residues are involved in the ligand-OR interaction.
Also, computational docking shows that ligands tested (Figures 6a-b) are clustered within
a single region, we can only surmise from the docking results that this region is the
preferred binding region for this OR..
Conclusion
This informatics-based study, supported by experimental results, identifies an OR
possessing atypical sequence-structure features while still maintaining olfactory
functionality. The human olfactory repertoire reveals that the ratio of functional ORs to
pseudogenes is 1:2 (
http://senselab.med.yale.edu/senselab/ORDB/humanOR.html
). This
number has been revised more recently and will be likely revised as more information
becomes available and more genome level experiments are carried out.
Evolutionarily, hOR17-210 could occupy a position of transition between
functional and pseudogenic ORs. This receptor is a possible illustration of how loss in
OR function may occur, namely, through mutations that create unfavorable sequences for
transmembrane helical assembly. Our study, we hope, will cause researchers to reassess
the sequence-structure-function correlates in olfactory receptors, and also the necessity to
incorporate structural features in the classification of ORs and GPCRs.
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
We have used bioinformatics methods to show how and why a receptor appearing
pseudogenic in several portions of the population can be functional in others.
Functionality was confirmed by measuring the experimental, varying excitatory
responses to odor ligands with different of functional groups. While hOR17-210 appears
to lack the first two TMs typically observed in ORs, it possesses an additional TM
present in only two other non-human olfactory receptors in all of GenBank. This TM,
named TM 7', may preserve olfactory function within this OR (when functional) by
maintaining the TM structure, thus protecting the binding odor ligand. The intracellular
positions of regions identified as possibly responsible for olfactory function, due to their
highly conserved nature, are preserved. hOR17-210 possibly straddles the point in
mammalian OR evolution where loss of function occurs.
Bibliography
1.
Ji, T.H., Grossmann, M. & Ji, I. G protein-coupled receptors. I. Diversity of
receptor-ligand interactions. J Biol Chem 273, 17299-302 (1998).
2.
Muller, G. Towards 3D structures of G protein-coupled receptors: a
multidisciplinary approach. Curr Med Chem 7, 861-88 (2000).
3.
King, N., Hittinger, C.T. & Carroll, S.B. Evolution of key cell signaling and
adhesion protein families predates animal origins. Science 301, 361-3 (2003).
4.
Mombaerts, P. Molecular biology of odorant receptors in vertebrates. Annu Rev
Neurosci 22, 487-509 (1999).
5.
Malnic, B., Hirono, J., Sato, T. & Buck, L.B. Combinatorial receptor codes for
odors. Cell 96, 713-23 (1999).
6.
Touhara, K. et al. Functional identification and reconstitution of an odorant
receptor in single olfactory neurons. Proc Natl Acad Sci U S A 96, 4040-5 (1999).
7.
Abaffy, T., Malhotra, A. & Luetje, C.W. The molecular basis for ligand
specificity in a mouse olfactory receptor: a network of functionally important
residues. J Biol Chem 282, 1216-24 (2007).
8.
Bozza, T., Feinstein, P., Zheng, C. & Mombaerts, P. Odorant receptor expression
defines functional units in the mouse olfactory system. J Neurosci 22, 3033-43
(2002).
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
9.
Bruch, R.C. & Rulli, R.D. Ligand binding specificity of a neutral L-amino acid
olfactory receptor. Comp Biochem Physiol B 91, 535-40 (1988).
10.
Katada, S., Hirokawa, T., Oka, Y., Suwa, M. & Touhara, K. Structural basis for a
broad but selective ligand spectrum of a mouse olfactory receptor: mapping the
odorant-binding site.
J Neurosci 25, 1806-15 (2005).
11.
Mombaerts, P. Targeting olfaction. Curr Opin Neurobiol 6, 481-6 (1996).
12.
Mombaerts, P. Odorant receptor gene choice in olfactory sensory neurons: the one
receptor-one neuron hypothesis revisited. Curr Opin Neurobiol 14, 31-6 (2004).
13.
Oka, Y., Omura, M., Kataoka, H. & Touhara, K. Olfactory receptor antagonism
between odorants. Embo J 23, 120-6 (2004).
14.
Rothman, A., Feinstein, P., Hirota, J. & Mombaerts, P. The promoter of the
mouse odorant receptor gene M71. Mol Cell Neurosci 28, 535-46 (2005).
15.
Touhara, K. Odor discrimination by G protein-coupled olfactory receptors.
Microsc Res Tech 58, 135-41 (2002).
16.
Shepherd, G.M. The cognitive neurosciences. in The Cognitive Neurosciences: A
Handbook for the Field (eds. Gazzaniga, M.S. & Bizzi, E.) 105-102 (MIT Press,
Cambridge, Mass., 1995).
17.
Buck, L.B. Information coding in the vertebrate olfactory system. Annu Rev
Neurosci 19, 517-44 (1996).
18.
Glusman, G., Yanai, I., Rubin, I. & Lancet, D. The complete human olfactory
subgenome. Genome Res 11, 685-702 (2001).
19.
Niimura, Y. & Nei, M. Evolution of olfactory receptor genes in the human
genome. Proc Natl Acad Sci U S A 100, 12235-40 (2003).
20.
Malnic, B., Godfrey, P.A. & Buck, L.B. The human olfactory receptor gene
family. Proc Natl Acad Sci U S A 101, 2584-9 (2004).
21.
Zozulya, S., Echeverri, F. & Nguyen, T. The human olfactory receptor repertoire.
Genome Biol 2, RESEARCH0018 (2001).
22.
Zhang, X. & Firestein, S. The olfactory receptor gene superfamily of the mouse.
Nat Neurosci 5, 124-33 (2002).
23.
Young, J.M. et al. Odorant receptor expressed sequence tags demonstrate
olfactory expression of over 400 genes, extensive alternate splicing and unequal
expression levels. Genome Biol 4, R71 (2003).
24.
Quignon, P. et al. The dog and rat olfactory receptor repertoires. Genome Biol 6,
R83 (2005).
25.
Niimura, Y. & Nei, M. Comparative evolutionary analysis of olfactory receptor
gene clusters between humans and mice. Gene 346, 13-21 (2005).
26.
Niimura, Y. & Nei, M. Extensive gains and losses of olfactory receptor genes in
Mammalian evolution. PLoS ONE 2, e708 (2007).
27.
Sharon, D. et al. Primate evolution of an olfactory receptor cluster: diversification
by gene conversion and recent emergence of pseudogenes. Genomics 61, 24-36
(1999).
28.
Menashe, I., Man, O., Lancet, D. & Gilad, Y. Population differences in haplotype
structure within a human olfactory receptor gene cluster. Hum Mol Genet 11,
1381-90 (2002).
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
29.
Matarazzo, V. et al. Functional characterization of two human olfactory receptors
expressed in the baculovirus Sf9 insect cell system. Chem Senses 30, 195-207
(2005).
30.
Imai, T., Suzuki, M. & Sakano, H. Odorant receptor-derived cAMP signals direct
axonal targeting.
Science 314, 657-61 (2006).
31.
Fuchs, T., Glusman, G., Horn-Saban, S., Lancet, D. & Pilpel, Y. The human
olfactory subgenome: from sequence to structure and evolution. Hum Genet 108,
1-13 (2001).
32.
Visiers, I., Ballesteros, J.A. & Weinstein, H. Three-dimensional representations of
G protein-coupled receptor structures and mechanisms. Methods Enzymol 343,
329-71 (2002).
33.
Tusnady, G.E. & Simon, I. The HMMTOP transmembrane topology prediction
server. Bioinformatics 17, 849-50 (2001).
34.
Moller, S., Vilo, J. & Croning, M.D. Prediction of the coupling specificity of G
protein coupled receptors to their G proteins. Bioinformatics 17 Suppl 1, S174-81
(2001).
35.
Araneda, R.C., Kini, A.D. & Firestein, S. The molecular receptive range of an
odorant receptor. Nat Neurosci 3, 1248-55 (2000).
36.
Singer, M.S. Analysis of the molecular basis for octanal interactions in the
expressed rat 17 olfactory receptor. Chem Senses 25, 155-65 (2000).
37.
Lai, P.C., Singer, M.S. & Crasto, C.J. Structural activation pathways from
dynamic olfactory receptor-odorant interactions. Chem Senses 30, 781-92 (2005).
38.
John, B. & Sali, A. Comparative protein structure modeling by iterative
alignment, model building and model assessment. Nucleic Acids Res 31, 3982-92
(2003).
39.
Melen, K., Krogh, A. & von Heijne, G. Reliability measures for membrane
protein topology prediction algorithms. J Mol Biol 327, 735-44 (2003).
40.
Okada, T. X-ray crystallographic studies for ligand-protein interaction changes in
rhodopsin. Biochem Soc Trans 32, 738-41 (2004).
41.
Gschwend, D.A., Good, A.C. & Kuntz, I.D. Molecular docking towards drug
discovery. J Mol Recognit 9, 175-86 (1996).
42.
Gschwend, D.A. & Kuntz, I.D. Orientational sampling and rigid-body
minimization in molecular docking revisited: on-the-fly optimization and
degeneracy removal. J Comput Aided Mol Des 10, 123-32 (1996).
43.
Richards, F.M. Areas, volumes, packing and protein structure. Annu Rev Biophys
Bioeng 6, 151-76 (1977).
44.
Buck, L. & Axel, R. A novel multigene family may encode odorant receptors: a
molecular basis for odor recognition. Cell 65, 175-87 (1991).
45.
Burger, M. et al. Point mutation causing constitutive signaling of CXCR2 leads to
transforming activity similar to Kaposi's sarcoma herpesvirus-G protein-coupled
receptor. J Immunol 163, 2017-22 (1999).
46.
Scheer, A., Fanelli, F., Costa, T., De Benedetti, P.G. & Cotecchia, S.
Constitutively active mutants of the alpha 1B-adrenergic receptor: role of highly
conserved polar amino acids in receptor activation. Embo J 15, 3566-78 (1996).
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
47.
Benton, R., Sachse, S., Michnick, S.W. & Vosshall, L.B. Atypical membrane
topology and heteromeric function of Drosophila odorant receptors in vivo. PLoS
Biol 4, e20 (2006).
48.
Otaki, J.M. & Firestein, S. Length analyses of mammalian G-protein-coupled
receptors.
J Theor Biol 211, 77-100 (2001).
49.
Olender, T., Feldmesser, E., Atarot, T., Eisenstein, M. & Lancet, D. The olfactory
receptor universe - from whole genome analysis to structure and evolution. Genet
Mol Res 3, 545-53 (2004).
50.
Yohannan, S., Faham, S., Yang, D., Whitelegge, J.P. & Bowie, J.U. The evolution
of transmembrane helix kinks and the structural diversity of G protein-coupled
receptors. Proc Natl Acad Sci U S A 101, 959-63 (2004).
51.
Katada, S. & Touhara, K. [A molecular basis for odorant recognition: olfactory
receptor pharmacology]. Nippon Yakurigaku Zasshi 124, 201-9 (2004).
52.
Krebs, A., Villa, C., Edwards, P.C. & Schertler, G.F. Characterisation of an
improved two-dimensional p22121 crystal from bovine rhodopsin. J Mol Biol
282, 991-1003 (1998).
53.
Vaidehi, N. et al. Prediction of structure and function of G protein-coupled
receptors. Proc Natl Acad Sci U S A 99, 12622-7 (2002).
54.
Singer, M.S. & Shepherd, G.M. Molecular modeling of ligand-receptor
interactions in the OR5 olfactory receptor. Neuroreport 5, 1297-300 (1994).
List of Figures
1a) Results of the sequence alignment between OR17-210 cDNA found in GENBANK
Accession number (AAC99555) and OR1e3P genomic DNA found in the HORDE
database. The functional region in OR17-210 begins from nucleotide 170. This is caused
by a two-residue frame shift in the genomic DNA. The sequence of the functional
protein also contains an added region beginning from nucleotide number 977. This
orphan TM 7' and the extracellular C-termini are contained in this region. The frame
shift results in a stop codon beyond nucleotide 1030.
1b) Results of the translation of the genomic DNA for Or1e3P as found in the HORDE
database. The presence of stop codons indicates that the receptor is pseudogenic as
listed.
1c) Results of the translation of the genomic DNA of OR1e3P as found in the HORDE
database, but following a 2-nucleotide frame shift. This sequence is however, is missing
the 3' region that resulted in the orphan TM observed in ACC99555 (the sequence used
in the functional studies).
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
2. Figure shows the results of Hidden Markov Model predictions of termini, intra and
extra-cellular loops in hOR17-210. Two different profiling programs were used,
TMHMM and HMMTOP. The yellow highlighted regions show the predicted TM
helices. The blue colored regions indicate the extra-cellular N-termini which contains
MPMY polypeptide motif, which marks the beginning of TM2 in most ORs. The region
last highlighted region is the orphan TM 7' region. The red colored region shows that the
C-terminus of this protein is extracellular.
3. Figure shows the results of a sequence alignment with rat I7, here represented as a
typical olfactory receptor, and hOR17-210. The highlighted regions indicating the TM
domains assigned to the model show that 17-210 lacks TMs 1 and 2, that the MPMY
region is extracellular. It shows alignment between TM1 of hOR17-210 and I7, with the
HCY of OR17-210 and the DRY of I7 aligned in the intracellular loop. The figure also
shows strong alignment between the third intracellular loop of OR17-210 and the C-
terminus of I7, before the origination of TM 7' in OR17-210. Yellow segments show
final TM helical assignments used in the models.
4. Figure shows the results of sequence alignment of hOR17-210, its predicted
chimpanzee homolog and predicted OR in cow (Orl466-homolog). Each OR shows
atypical features of the polypeptide region beginning with PMY not being a TM, and the
existence of a TM 7'. Additionally, the chimpanzee and the cow OR gene products show
the existence of a TM 1. Residues highlighted in yellow are regions predicted by
TMHMM to be transmembrane domains.
5a: Figure shows a structural model for OR17-210 with the TM 7' occupying the position
typically occupied by TM 1 in rhodopsin-like GPCRs.
5b: Figure shows a structural model for OR17-210 with the TM 7' occupying the position
typically occupied by TM 2 in rhodopsin-like GPCRs.
6a: Figure shows the docking of three ligands with ring structures: beta ionone (green),
D-camphor (yellow) and L-camphor (pink). The figure shows the proximity of the
docked ligands to ALA108 in white. The binding is expectedly in the region bound by
TMs 3 (1), 4 (2), 5(3) and 6(4). The TM identifiers are numbers typical of ORs and
GPCRs. The numbers in parentheses are TM numbers for hOR17-210.
6b: Figure shows the docking of five ligands straight chains: decanol (yellow),
nonanone(green), nonanol (pink), 2-undecanone (orange) and 6-undecanone (white). The
figure shows the proximity of the docked ligands to ALA108 in white. The binding is
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
expectedly in the region bound by TMs 3 (1), 4 (2), 5(3) and 6(4). The TM identifiers are
numbers typical of ORs and GPCRs. The numbers in parentheses are TM numbers for
hOR17-210.
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007
Nature Precedings : doi:10.1038/npre.2007.1290.1 : Posted 2 Nov 2007